8urn:lsid:arphahub.com:pub:A71ED5FC-60ED-5DA3-AC8E-F6D2BB5B3573urn:lsid:zoobank.org:pub:C8FA3ADA-5585-4F26-9215-A520EE683979Comparative CytogeneticsCCG1993-07711993-078XPensoft Publishers10.3897/CompCytogen.v11i4.1062010620Research ArticleAnimaliaArachnidaAraneaeArthropodaChelicerataCtenidaeInvertebrataGeneticsCytogenetic analysis of five Ctenidae species (Araneae): detection of heterochromatin and 18S rDNA sitesRincãoMatheus Piresrincaom@gmail.com1ChavariJoão Lucas2BrescovitAntonio Domingoshttps://orcid.org/0000-0002-1511-53242DiasAna Lúciaanadias@uel.br1Laboratory of Animal Cytogenetics; Department of General Biology, CCB, Universidade Estadual de Londrina. Rodovia Celso Garcia Cid, PR 445, km 380, Londrina-BrasilUniversidade Estadual de LondrinaLondrinaBrazilSpecial Laboratory of Biological Collections, Instituto Butantan, São Paulo, BrazilInstituto ButantanSão PauloBrazil
201714092017114627639FC14FFCA-7C78-0777-FF87-FF924E1A061543C531D9-727A-4EBD-B293-F1B22BB1F85411390462309201619072017Matheus Pires Rincão, João Lucas Chavari, Antonio Domingos Brescovit, Ana Lúcia DiasThis is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.http://zoobank.org/43C531D9-727A-4EBD-B293-F1B22BB1F854
The present study aimed to cytogenetically analyse five Ctenidae species Ctenusornatus (Keyserling, 1877), Ctenusmedius (Keyserling, 1891), Phoneutrianigriventer (Keyserling, 1891), Viracuchaandicola (Simon, 1906), and Enoploctenuscyclothorax (Philip Bertkau, 1880), from Brazil. All species presented a 2n♂ = 28 except for V.andicola, which showed 2n♂ = 29. Analysis of segregation and behavior of sex chromosomes during male meiosis showed a sex chromosome system of the type X1X20 in species with 28 chromosomes and X1X2X30 in V.andicola. C banding stained with fluorochromes CMA3 and DAPI revealed two distributions patterns of GC-rich heterochromatin: (i) in terminal regions of most chromosomes, as presented in C.medius, P.nigriventer, E.cyclothorax and V.andicola and (ii) in interstitial regions of most chromosomes, in addition to terminal regions, as observed for C.ornatus. The population of Ubatuba (São Paulo State) of this same species displayed an additional accumulation of GC-rich heterochromatin in one bivalent. Fluorescent in situ hybridization revealed that this bivalent corresponded to the NOR-bearing chromosome pair. All analyzed species have one bivalent with 18S rDNA site, except P.nigriventer, which has three bivalents with 18S rDNA site. Karyotypes of two species, C.medius and E.cyclothorax, are described for the first time. The latter species is the first karyotyped representative of the subfamily Acantheinae. Finally, 18S rDNA probe is used for the first time in Ctenidae at the present study.
C-bandingFISHfluorochromemeiosisspider cytogeneticssex chromosomesCoordenação de Aperfeiçoamento de Pessoal de Nível Superior501100002322http://doi.org/10.13039/501100002322Citation
Rincão MP, Chavari JL, Brescovit AD, Dias AL (2017) Cytogenetic analysis of five Ctenidae species (Araneae): detection of heterochromatin and 18S rDNA sites. Comparative Cytogenetics 11(4): 627–639. https://doi.org/10.3897/CompCytogen.v11i4.10620
Introduction
Ctenidae is a family of Araneae distributed throughout the tropical region of the planet (World Spider Catalog 2017). This family includes wandering and nocturnal spiders, with some species of medical interest, such as those of the genus Phoneutria Perty, 1833 (Ministério da Saúde 2017). Ctenidae is divided into five subfamilies, namely Acanthocteninae, Viridasiinae, Cteninae, Calocteninae, and Acantheinae (Silva-Dávila 2003; Polotow and Brescovit 2014). Although ctenids are of great ecological and medical importance, studies on their cytogenetics are scarce (Table 1) and cytogenetic data for the last two subfamilies are not available to date.
Cytogenetic data of Ctenidae species, updated from Araujo et al. (2014), including the data of present study. NOR = nucleolus organizer region.
Species
Karyotype (♂)
NORs
Reference
Silver Nitrate
detection of 18S rDNA
Acantheinae
Enoploctenuscyclothorax (Bertkau, 1880)
28, X1X20
2
Present study
Acanthocteninae
Nothroctenus sp.
29, X1X2X30
Araujo et al. 2014
Viracuchaandicola (Simon, 1906)
29, X1X2X30
4
Araujo et al. 2014
2
Present study
Cteninae
Anahitafauna Karsch, 1879
29, X1X2X30
Chen, 1999
Ctenusindicus (Gravely, 1931)
28, X1X20
4
Kumar et al. 2016
Ctenusmedius Keyserling, 1891
28, X1X20
2
Present study
Ctenusornatus (Keyserling, 1877)
28, X1X20
2
Araujo et al. 2014
Ctenus sp.
28, X1X20
Araujo et al. 2014
Parabatinabrevipes (Keyserling, 1891)
28, X1X20
Araujo et al. 2014
Phoneutrianigriventer (Keyserling, 1891)
28, X1X20
2
Araujo et al. 2014
6
Present study
Viridasiinae
Asthenoctenusborelli Simon, 1897
22, X1X20
Araujo et al. 2014
Three karyotypes have been observed in the family: (i) 2n♂ = 22 (20 + X1X20); (ii) 2n♂ = 28 (26 + X1X20); and (iii) 2n♂ = 29 (26 + X1X2X30) (Table 1). The sex chromosome systems (SCS) in spiders are considered highly diverse by many authors (Král et al. 2006; 2011; Araujo et al. 2012) ranging from simple systems, such as XY or X0, to multiple SCS as XnYn or Xn0 (Araujo et al. 2017). Based on findings in a specimen of Ctenusornatus (Keyserling, 1877) Araujo et al. (2014) suggested that the X1X2X30 system in Ctenidae, might have arisen from a supernumerary chromosome and, according to literature evidence, this system arose repeatedly in the evolutionary history of Entelegynae and its conversion into the X1X20 system and vice-versa is a recurring event. Bole-Gowda (1952) also suggested the involvement of a supernumerary element in the origin of the X3 chromosome in Sparassidae species. Other hypotheses on the conversion of a X1X20 into a X1X2X30 were also proposed by some authors (Pätau 1948; Postiglioni and Brum-Zorrilla 1981; Parida and Sharma 1986). The conversion of a X1X2X30 into a X1X20 was firstly proposed in the spider genus Malthonica Simon, 1898 (Agelenidae) by Král (2007), suggesting that tandem fusions occurred in this process.
Chromosome banding techniques, as identification of nucleolus organizer regions (NORs) using silver nitrate impregnation, have been performed in Ctenidae. Araujo et al. (2014) found a single terminal NOR on one autosomal pair in C.ornatus and Phoneutrianigriventer (Keyserling, 1891), and on two pairs in Viracuchaandicola (Simon, 1906). Kumar et al. (2016) also detected NORs on two autosomal pairs in Ctenusindicus (Gravely, 1931). However, molecular cytogenetic studies are scarce in spiders. There have been only five studies about distribution of some sequences using fluorescence in situ hybridization (FISH): location of 18S rDNA sites in Wadicosafidelis (O. Pickard-Cambridge, 1872) (Lycosidae) (Forman et al. 2013) and Brachypelmaalbopilosum Valerio, 1980 (Theraphosidae) (Král et al. 2013); 5S rDNA sites in Oxyopessertatus L. Koch, 1878 (Oxyopidae) (Suzuki and Kubota 2011); mapping of silk genes in Latrodectushesperus Chamberlin & Ivie, 1935 and Latrodectusgeometricus C. L. Koch, 1841 (Theridiidae) (Zhao et al. 2010); and ocurrence of telomeric repeats in Brachypelmaalbopilosa Valerio, 1980 (Vítková et al. 2005).
Considering the great importance of ctenids and the scarcity of cytogenetic studies in the group, our study analyzed the mitotic and meiotic chromosomes of five species of this family. To understand better the karyotype structure in this group of spiders, we evaluated the behavior of sex chromosomes, heterochromatin composition/distribution pattern, and the location of 18S rDNA sites.
Material and methodsSpecimen deposition
Adults and juveniles of five ctenid species from different collection sites in Brazil were analyzed, as listed in Table 2. Specimens were deposited in the arachnological collection of the Laboratório Especial de Coleções Biológicas at Instituto Butantan (IBSP, curator A. D. Brescovit), São Paulo/SP (São Paulo state), Brazil.
List of collected species, with the number of the individuals, collection sites, and voucher numbers. PR = Paraná State. SP = São Paulo State.
Chromosomal preparations were obtained according to Araujo et al. (2008), with some modifications as follows. After the fixation, testes were dissociated in a drop of 60% acetic acid on the surface of a microscope slide and covered with a coverslip, pressed and immersed in liquid nitrogen to allow the removal of the coverslip. The diploid number was determined by counting 30 meiotic and mitotic cells. The morphology of chromosomes was classified according to Levan et al. (1964), using the MicroMeasure version 3.3 software (Reeves and Tear 2000). To determine the heterochromatin location and its composition, the slides were submitted to C-banding following Sumner (1972) and subsequently stained with base-specific fluorochromes, chromomycin A3 (CMA3) and 4’, 6-diamidino2-phenilindole (DAPI), according to the procedure described by Schweizer (1980).
18S rDNA probe generation
Genomic DNA of C.ornatus was extracted using a standard phenol/chloroform procedure (Sambrook and Russell 2006). A polymerase chain reaction (PCR) was performed with the primers of 18S rDNA, forward: CGAGCGCTTTTATTAGACCA and reverse: GGTTCACCTACGGAAACCTT, as described by Forman et al. (2013). Another pair of primers was designed in the Primer3Plus software (Untergasser et al. 2007) to allow the complete amplification of the 18S rDNA fragment, forward: TCTGTCTCGTGCGGCTAAAC and reverse: GATCCATTGGAGGGCAAGTC. The PCR reaction contained diluted genomic DNA, Taq buffer, 0.8 mM dNTP mix, 4 mM MgCl2, 5 pmol of each primer, and 2.5 U of Taq polymerase (Invitrogen) for a reaction of 25 µl. The amplification was performed with an initial denaturation of 2 min at 94 °C, followed by 40 cycles of 1 min at 94 °C, 1 min at 60 °C, and 5 min at 72 °C until completion. The 18S rDNA was purified by agarose gel using the Pure Link-Quick Gel Extraction Kit (Invitrogen). The DNA fragment generated by the pair of primers described by Forman et al. (2013) was cloned using the kit pGEM-T Easy Vector System (Promega) in a suitable strain of Escherichiacoli (TOP 10) and the insert was sequenced by the ABI-Prism 3500 Genetic Analyzer (Applied Biosystems).
The sequence was analyzed using the free software BioEdit, version 7.2.5 (Hall 2013). The rDNA sequence of 1280 pb, obtained from C.ornatus, was submitted to BLASTN (Altschul et al., 1990) in the National Center for Biotechnology Information (NCBI) database, through web site (http://www.ncbi.nlm.nih.gov/blast), to verify the homology with sequences of 18S rDNA from spiders and demonstrated 99% of homology with Phoneutriafera Perty, 1833 (accession KY016373.1) in the GenBank. The sequence was deposited on NCBI, accession KT698160.1.
Fluorescence in situ hybridization
The 18S rDNA sites were identified using the FISH technique according to Pinkel et al. (1986) and Gouveia et al. (2013), with the following modifications. After dehydration, the slides were treated with formamide 15%/SSC for 10 min and subsequently in pepsin (0.005 mg/mL) for 20 min. Probes were labeled with the Dig-Nick Translation kit (Invitrogen) and detected by the monoclonal anti-digoxigenin antibody conjugated to rhodamine (Roche Applied Science, Indianapolis, IN). Preparations were counter-stained with DAPI. In the Ubatuba C.ornatus population, the slides were stained after a FISH procedure with CMA3 and DAPI to visualize the association between 18S rDNA sites and GC-rich blocks. Finally, the slides were analyzed in an epifluorescence microscope (Leica DM 2000), equipped with a digital camera Moticam Pro 282B. The images were captured using the Motic Images Advanced software, version 3.2.
Results
Ctenusornatus, Ctenusmedius Keyserling, 1891, Phoneutrianigriventer, and Enoploctenuscyclothorax (Bertkau, 1880) exhibited 2n♂ = 28, as observed in mitotic metaphases (Fig. 1A, E, I, M), whereas Viracuchaandicola presented 2n♂ = 29 (Fig. 1Q). All chromosomes were identified in metaphases II as acrocentric (Fig. 1D, H, L), except for E.cyclothorax and V.andicola, in which it was difficult to determine accurately the morphology of all chromosomes (Fig. 1P, T).
At male diakinesis 13 bivalents in all species were found and two univalent X in parallel association in the species with 28 chromosomes (Fig. 1C, G, K, O) and three univalent X in the species with 29 chromosomes (Fig. 1S). Three sex chromosomes in V.andicola showed parallel association (Fig. 1S-box). In some plates at pachytene and diplotene X are not associated in species with the two X chromosomes (Fig. 1C, G, K, O-boxes). Species with 2n♂ = 28 showed metaphases II with 13 and 15 chromosomes (Fig. 1D, H, L, P), and species with 2n♂ = 29 showed cells with 13 and 16 chromosomes (Fig. 1T), that confirm sex chromosome systems of the types X1X20 and X1X2X30, respectively. In species with 28 chromosomes, two positively heteropycnotic bodies were observed in pachytene stage (Fig. 1B, F, J, N) and V.andicola exhibited three positive heteropycnotic bodies (Fig. 1R), identified as the sex chromosomes.
Ctenusornatus presented interstitial and terminal CMA3+ bands (Fig. 2A). Nevertheless, the population of Ubatuba (São Paulo state) presented an additional large terminal CMA3+ block in a bivalent (Fig. 2C). In C.medius (Fig. 2E), P.nigriventer (Fig. 2G), V.andicola (Fig. 2I), and E.cyclothorax (Fig. 2K), all populations showed only CMA3+ terminal blocks. Karyotypes contained no DAPI+ blocks (Fig. 2B, D, F, H, J, L).
The FISH revealed one bivalent with 18S rDNA site in C.ornatus (Fig. 3A), C.medius (Fig. 3B), V.andicola (Fig. 3D), and E.cyclothorax (Fig. 3E). C.ornatus presented size polymorphism of the 18S rDNA site (Fig. 3A-box). P.nigriventer showed three bivalents exhibiting 18S rDNA site; however, one of these bivalents presented site only in one chromosome (Fig. 3C).
Metaphase II of C.ornatus from the Ubatuba population submitted to FISH and subsequently to CMA3/DAPI also revealed that CMA+ sites with higher accumulation of GC-rich heterochromatin are co-localized to the sites carrying 18S rDNA (Fig. 4).
25E6F484-F42A-5697-B054-8EECD41C79A6
Male mitotic and meiotic cells of Ctenidae species stained with Giemsa. Boxes – X chromosomes without association (C, G, K, O), and with association (S). C.medius (A–D), C.ornatus (E–H), P.nigriventer (I–L), E.cyclothorax (M–P), V.andicola (Q–T). The arrowheads show sex chromosomes. Mitotic metaphases with 2n = 28 (A, E, I, M) and 2n =29 (Q). Pachytene cells (B, F, J, N, R) with positively heteropycnotic sex chromosomes. Diakinesis cells (C, G, K, O, S), note parallel association of two X chromosomes (C, G, K, O) or three X chromosomes without association (S). Metaphase II cells with n = 13 and n = 13 + X1X2(D, H, L, P) and n = 13 and n = 13 + X1X2X3(T). Bar = 10 µm.
Ctenidae male mitotic and meiotic cells, C-banding and staining with base-specific fluorochromes CMA3 (A, C, E, G, I, K) and DAPI (B, D, F, H, J, L). Arrowhead - X chromosomes. A, B mitotic metaphase of Ctenusornatus, 28 chromosomes, arrow – interstitial CMA3+ region C, D diakinesis of C.ornatus, Ubatuba population, arrow – bivalent with large CMA3+ block E, F diakinesis of C.mediusG, H mitotic metaphase of Phoneutrianigriventer, 2n=28 I, J diakinesis of ViracuchaandicolaK, L diakinesis of Enoploctenuscyclothorax. Bar = 10 µm.
Ctenidae male meiotic cells, FISH with rDNA 18S probe. Arrowhead - sex chromosomes. A diakinesis of Ctenusornatus: in the box the bivalent with size heteromorphism of 18S rDNA sites B diakinesis of CtenusmediusC diakinesis of Phoneutrianigriventer: arrow - bivalent with 18S rDNA sites in only one of the chromosomes D diplotene of ViracuchaandicolaE diplotene of Enoploctenuscyclothorax. Bar = 10 µm.
Chromosomes of Ctenusornatus, Ubatuba/São Paulo state. A Metaphase II, FISH with rDNA 18S probe B sequential staining with DAPI/CMA3 in the same metaphase II, showing association between sites of GC-rich heterochromatin and rDNA 18S regions. Note the presence of more than one metaphase II. Bar = 10 µm.
https://binary.pensoft.net/fig/155470Discussion
The conventional analysis showed diploid number, chromosomal morphology, sex chromosome system and meiotic behavior of five Ctenidae species. The present study presents the first data for Acantheinae, increasing to four the number of ctenid subfamilies with cytogenetic data (Table 1), and the first cytogenetic study in C.medius and E.cyclothorax. In Ctenidae, the diploid number variation occurs basically due to the differences in SCS: species with 2n♂ = 28 exhibit a SCS of the type X1X20, whereas species with 2n♂ = 29 have the type X1X2X30. Only A.borellii (Viridasiinae) presents 2n♂ = 22, with SCS of the type X1X20 (Chen 1999, Araujo et al. 2014, Kumar et al. 2016).
The parallel association between sex chromosomes during male meiosis is a common pattern observed in Entelegynae (Král et al. 2011; Araujo et al. 2012), and also found in Ctenidae (Chen 1999; Araujo et al. 2014; Kumar et al. 2016). Forman et al. (2013) observed absence of sex chromosome pairing in some plates of Wadicosafidelis. They proposed that it might be due to chromosome preparation. A similar situation may have occurred in species analyzed in this study.
We observed two distinct distribution patterns of the GC-rich heterochromatin: (i) bands distributed in terminal regions of most chromosomes, as presented in C.medius, P.nigriventer, E.cyclothorax and V.andicola; and (ii) bands present in interstitial regions of most chromosomes, in addition to the terminal regions, as observed for C.ornatus. The first pattern could arise by dispersion of heterochromatin due to contact of chromosomes during their polarization of Rabl in mitosis or during bouquet orientation at the early prophase I as described by Schweizer and Loidl (1987). The second pattern could arise by occurrence of chromosomal rearrangements (Schweizer and Loidl 1987) or by spreading of the heterochromatin by transposable elements, as proposed for grasshopper (Rocha et al. 2015). Furthermore, despite the few species studied, GC-rich blocks seem to be common in entelegyne spiders (Araujo et al. 2005; Ramalho et al. 2008, Chemisquy et al. 2008). They were also found in Ctenidae species in the present study. The heterochromatin distribution also allowed to distinguish C.ornatus from Ubatuba population of other C.ornatus populations here analyzed.
The present study revealed a massive accumulation of GC-rich heterochromatin associated with 18S rDNA site in C.ornatus from Ubatuba. Association of GC-rich heterochromatin with NORs is common in many animal groups, for example in fishes (Ferro et al. 2001) and amphibians (Schmid 1980). In spiders, this association has been reported in Nephilingyscruentata (Araneidae) (Araujo et al. 2005).
Another characteristic observed in C.ornatus was the size heteromorphism of 18S rDNA sites. This can be explained by unequal crossing, which causes a greater accumulation of rDNA cistrons in one of the homologous chromosomes, as described by Ferro et al. (2001) and Teribele et al. (2008) in fish species. A similar situation may have occurred in P.nigriventer, very small 18S rDNA sites could exhibit low fluorescence, making detection difficult.
In Ctenidae, NOR in one bivalent seems to be the most commonly observed pattern. Only P.nigriventer presented more rDNA sites. This finding differs from Araujo et al. (2014), who observed only one chromosome pair carrying NOR in the same species using the silver nitrate impregnation that identifies only transcriptionally active sites. Specimens of V.andicola showed a single NOR as revealed by the FISH analysis. By contrast, the data exhibited by Araujo et al. (2014) showed NORs in two chromosome pairs, which could indicate an interpopulation variation, however the authors analyzed only one specimen, which hinders a more accurate study.
The present study brings new cytogenetic information and first FISH data for Ctenidae providing valuable contribution to the knowledge on karyotypes in this family.
Acknowledgments
The authors thank Dra. Renata da Rosa (UEL), reviewers and the sub-editor of Comparative Cytogenetics for their considerations and time in reviewing this article, and to Dra. Juceli Gonzalez Gouveia (UEMS) for his assistance related to molecular cytogenetic techniques. Authors also thank to Rafael Campos de Barros, Mailson Gabriel da Fonseca, and Robson Rockembacher (UEL) for their assistance with sample collection. This work was supported by the Capes and CNPq (ADB grant PQ 301776/2014-0; ALD grant 312529/2014-7).
ReferencesAltschulSFGishWMillerWMyersEWLipmanDJ (1990) Basic local alignment search tool.215(3): 403–410. https://doi.org/10.1016/S0022-2836(05)80360-2AraujoDCellaDMBrescovitAD (2005) Cytogenetic analysis of the neotropical spider Nephilengyscruentata (Araneomorphae, Tetragnathidae): standard staining NORs, C-bands, and base-specific fluorochromes.65(2): 193–202. https://doi.org/10.1590/S1519-69842005000200002AraujoDRheimsCABrescovitADCellaDM (2008) Extreme degree of chromosome number variability in species of the spider genus Scytodes (Araneae, Haplogynae, Scytodidae).46(2): 89–95. https://doi.org/10.1111/j.1439-0469.2007.00457.xAraujoDSchneiderMCPaula-NetoECellaDM (2012) Sex chromosomes and meiosis in spiders: a review. In: SwanA (Ed.) Meiosis – Molecular Mechanisms and Cytogenetic Diversity., 87–108. https://doi.org/10.5772/31612AraujoDOliveiraEGGirotiAMMattosVFPaula-NetoEBrescovitADSchneiderMCCellaDM (2014) Comparative cytogenetics of seven Ctenidae species (Aranae).31(2): 83–88. https://doi.org/10.2108/zsj.31.83AraujoDSchneiderMCPaula-NetoECellaDM (2017) The spider cytogenetic database. www.arthropodacytogenetics.bio.br/spiderdatabase [Accessed in: 28/04/2017]Bole-GowdaBN (1952) Studies on the chromosomes and the sexdetermining mechanism in four hunting spiders (Sparassidae).5: 51–70.ChemisquyMARodríguez-GilSGSciosciaCLMolaLM (2008) Cytogenetic studies of three Lycosidae species from Argentina (Arachnida, Araneae).31: 857–867. https://doi.org/10.1590/S1415-47572008005000022ChenS (1999) Cytological studies on six species of spiders from Taiwan (Araneae: Theridiidae, Psechridae, Uloboridae, Oxyopidae, and Ctenidae).38(4): 423–434.FerroDAMNéoDMMoreira-FilhoOBertolloLAC (2001) Nucleolar organizing regions, 18S and 5S rDNA in Astyanaxscabripinnis (Pisces, Characidae): populations distribution and functional diversity.110(1): 55–62. https://doi.org/10.1023/A:1017963217795FormanMNguyenPHulaVKrálJ (2013) Sex chromosome pairing and extensive NOR Polymorphism in Wadicosafidelis (Araneae: Lycosidae).141(1): 43–49. https://doi.org/10.1159/000351041GouveiaJGMoraesVPOSampaioTRRosaRDiasAL (2013) Considerations on karyotype evolution in the genera Imparfinis Eigenmann and Norris 1900 and Pimelodella Eigenmann and Eigenmann 1888 (Siluriformes: Heptapteridae).23(2): 215–227. https://doi.org/10.1007/s11160-012-9286-2HallT (2013) BioEdit, version 7.2.5. Ibis Biosciences, Carlsbad, CA, USA.KrálJMusilováJŠťáhlavskýFŘezáčMAkanZ (2006) Evolution of the karyotype and sex chromosome systems in basal clades of araneomorph spiders (Araneae: Araneomorphae).14(8): 859–880. https://doi.org/10.1007/s10577-006-1095-9KrálJ (2007) Evolution of multiple sex chromosomes in the spider genus Malthonica (Araneae: Agelenidae) indicates unique structure of the spider sex chromosome systems.15: 863–879. https://doi.org/10.1159/000323497KrálJKorínkováTFormanMKrkavcováL (2011) Insights into the meiotic behavior and evolution of multiple sex chromosome systems in spiders.133(1): 43–66. https://doi.org/10.1159/000323497KrálJKorínkováTKrkavcováLMusilováJFormanMetal (2013) Evolution of karyotype, sex chromosomes, and meiosis in mygalomorph spiders (Araneae: Mygalomorphae).109(2): 377–408. https://doi.org/10.1111/bij.12056KumarASVenuGJayaprakashGVenkatachalaiahG (2016) Studies on chromosomal characteristics of Ctenusindicus (Gravely 1931) (Araneae: Ctenidae). The Nucleus. https://doi.org/10.1007/s13237-016-0191-2LevanAFredgaKSandbergAA (1964) Nomenclature for centromeric position on chromosomes.52(2): 201–220. https://doi.org/10.1111/j.1601-5223.1964.tb01953.xMinistériosda Saúde (2017) SISNAM. http://www.portalsinan.saude.gov.br [Acessed in: 05/02/2017]ParidaBBSharmaNN (1986) Karyotype and spermatogenesis in an Indian hunting spider, Sparassus sp. (Sparassidae: Arachnida) with multiple sex chromosomes.40: 28–30.PätauK (1948) X-segregation and heterochromasy in the spider Araneareaumuri.2: 77–100. https://doi.org/10.1038/hdy.1948.5PinkelDStraumeTGrayJW (1986) Cytogenetic analysis using quantitative, high-sensitivity, fluorescence hybridization.83(9): 2934–2938. https://doi.org/10.1073/pnas.83.9.2934PolotowDBrescovitAD (2014) Phylogenetic analysis of the tropical wolf spider subfamily Cteninae (Arachnida, Araneae, Ctenidae).170(2): 333–361. https://doi.org/10.1111/zoj.12101PostiglioniABrum-ZorrillaN (1981) Karyological studies on Uruguayan spiders II. Sex chromosomes in spiders of the genus Lycosa (Araneae-Lycosidae).56(1): 47–53. https://doi.org/10.1007/BF00126929RamalhoMOAraujoDSchneiderMCBrescovitADCellaDM (2008) Mesabolivarbrasiliensis (Moenkhaus 1898) and Mesabolivarcyaneotaeniatus (Keyserling 1891)(Araneomorphae, Pholcidae): close relationship reinforced by cytogenetic analyses.36(2): 453–456. https://doi.org/10.1636/CSh07-132.1ReevesATearJ (2000) MicroMeasure for Windows, version 3.3. Free program distributed by the authors over the Internet from http://www.colostate.edu/Depts/Biology/MicroMeasureRochaMFPineMBdosSantos Oliveira EFALoretoVGalloRBdaSilva CRMde DomenicoFCdaRosa R (2015) Spreading of heterochromatin and karyotype differentiation in two Tropidacris Scudder, 1869 species (Orthoptera, Romaleidae).9(3): 435–450. https://doi.org/10.3897/CompCytogen.v9i3.5160SambrookJRussellDW (2006) Purification of nucleic acids by extraction with phenol: chloroform. Cold Spring Harbor Protocols. https://doi.org/10.1101/pdb.prot4455SchmidM (1980) Chromosome banding in Amphibia. IV. Differentiation of GC- and AT-rich chromosome region in Anura.77(1): 83–103. https://doi.org/10.1007/BF00292043SchweizerD (1980) Simultaneous fluorescent staining of R bands and specific heterochromatic regions (DA-DAPI bands) in human chromosomes.27: 190–193. https://doi.org/10.1159/000131482SchweizerDLoidlJ (1987) A model for heterochromatin dispersion and the evolution of C-bands patterns. In: StahlALucianiJMVagner-CapodanoAM (Eds) Chromosomes Today., 61–74. https://doi.org/10.1007/978-94-010-9166-4_7Silva-DávilaD (2003) Higher-level relationships of the spider family Ctenidae (Araneae: Ctenoidea).274: 1–86. https://doi.org/10.1206/0003-0090(2003)274<0001:HLROTS>2.0.CO;2SumnerAT (1972) A simple technique for demonstrating centromeric heterochromatin.75(1): 304–306. https://doi.org/10.1016/0014-4827(72)90558-7SuzukiGKubotaS (2011) 5S ribosomal DNA cluster of a lynx spider Oxyopessertatus includes a histone H2B-like gene in the spacer region (NTS).14: 3–8. https://doi.org/10.11352/scr.14.3TeribeleRGravenaWCarvalhoKGiuliano-CaetanoLDiasAL (2008) Karyotypic analysis in two species of fishes of the family Curimatidae: AgNO3, CMA3 and FISH with 18S probe.61(3): 211–215. https://doi.org/10.1080/00087114.2008.10589632UntergasserANijveenHRaoXBisselingTGeurtsRLeunissenJAM (2007) Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research 35 (suppl_2): W71–W74. https://doi.org/10.1093/nar/gkm306VítkóvaMKrálJTrautWZrzavýJMerecF (2005) The evolutionary origin of insect telomeric repeats, (TTAGG)n.13: 145–156. https://doi.org/10.1007/s10577-005-7721-0ZhaoYAyoubNAHayashiCY (2010) Chromosome mapping of dragline silk genes on the genomes of widow spider (Araneae, Theridiidae). PLoS ONE 5(9): e12804. https://doi.org/10.1371/journal.pone.0012804World Spider Catalog (2017) The World Spider Catalog, version 18.0. American Museum of Natural History. http://www.wsc.nmbe.ch [Accessed on: 24/06/2017]