Corresponding author: Nazar A. Shapoval (
Academic editor: Snejana Grozeva
The eukaryotic ribosomal DNA cluster consists of multiple copies of three genes,
Shapoval NA, Lukhtanov VA (2015) Intragenomic variations of multicopy ITS2 marker in
The eukaryotic ribosomal DNA (rDNA) cluster consists of three genes,
Ribosomal RNA genes have been widely used in taxonomy, biogeographic, phylogenetic analyses, and molecular cytogenetic studies (
Accordingly, rDNA can be excellent source of cytogenetic markers for comparative genomic studies, evolutionary studies as well as the genetic identification of species (
At the nucleotide sequence level coding regions and spacers can reveal phylogenetic relationships ranging from the level of major phyla of living organisms to the population level, because they differ widely in their rate of evolution (
Unlike highly conserved rRNA genes, non-coding fast evolving transcribed spacers have high level of interspecific variability. Therefore, the internal transcribed spacers are considered to be useful phylogenetic markers, specifically for low-level phylogenetic analyses.
During PCR all variants of
This paper addresses a more detailed analysis of intraindividual variability of
Butterflies (only males) were collected in NW Iran (Zagros mt., Kordestan provience) in 2007–2014. Bodies were placed in 2 ml plastic vials with 100% ethanol for DNA analysis. Wings were stored in glassine envelopes for morphological study. All samples are stored at Zoological Institute, St Petersburg, Russia.
ILYC2F 5`- GAGAAACATCCAGGACCACT - 3` and
ILYC2RB 5` - CTGATCTGAGGCCA ACG - 3`.
The PCR amplifications were performed either in 50 µl reaction volume containing ca. 10–20 ng genomic DNA and 0.5 mM of each primer, using 26 PCR Master Mix (Fermentas, Lithuania). The temperature profile was as follows: initial denaturation at 94 °C for 1 min, followed by 30 cycles of denaturation at 94 °C for 45 s, annealing at 50 °C for 45 s, and extension at 72 °C for 1 min with a final extension at 72 °C for 10 min.
Amplified fragments were purified using GeneJET Gel Extraction Kit (Fermentas, Lithuania). Purification was carried out according to the manufacturer’s protocol. The success of PCR amplification and purification was evaluated by electrophoresis of the products in 1% agarose gel. Purified PCR product was used for direct sequencing or subsequent cloning.
For each cloning, more than 500 clones were obtained. To check if the cloning procedures were successful, PCR with
Sequencing was carried out using 3500xL analyzer (Applied Biosystems). Not less than 300 ng of plasmid DNA template was used for sequencing procedure. Cloned fragments were analyzed edited and aligned in Bioedit Software.
A Bayesian approach for estimating phylogeny was used. Bayesian trees were inferred using partitioned models: GTR for nucleotide substitutions and standard model for indels as implemented in MRBAYES v. 3.2 (
Sequenced region contained 3` end of
Examples of results from direct sequencing of
To elucidate the visible heterogeneity, the amplicons for 2 specimens of
Variable positions among sequenced clones.
Specimen | Clone number | Position | |||||||||||||||||||||||||||||||||||||||||
|
130 |
|
171 | 172 | 173 | 235 | 316 |
|
329 | 330 | 331 | 332 | 333 | 334 | 335 |
|
|
338 | 339 | 340 | 341 | 342 | 343 | 344 |
|
346 | 356 | 400 | 414 | 465 | |||||||||||||
W136 |
#01 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
W136 |
#02 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
W136 |
#03 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
W136 |
#04 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
W136 |
#05 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
W136 |
#06 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
W136 |
#07 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
W136 |
#08 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
W136 |
#09 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
W136 |
#10 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
14 | 41 |
|
|
169 | 170 | 171 | 176 | 184 | 185 | 186 | 187 | 188 | 189 | 190 | 191 | 192 | 193 | 194 | 195 | 196 | 197 | 198 | 199 | 200 | 235 | 236 |
|
|
|
338 |
|
|
356 | ||||||||||
W202 |
#01 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||
W202 |
#02 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||
W202 |
#03 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||
W202 |
#04 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||
W202 |
#05 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||
W202 |
#06 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||
W202 |
#07 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||
W202 |
#08 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||
W202 |
#09 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||
W202 |
#10 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||
20 | 150 | 154 | 155 | 166 | 239 | 340 | 341 | 342 | |||||||||||||||||||||||||||||||||||
V145 |
#01 |
|
|
|
|
|
|
|
|
|
|||||||||||||||||||||||||||||||||
V145 |
#02 |
|
|
|
|
|
|
|
|
|
|||||||||||||||||||||||||||||||||
V145 |
#03 |
|
|
|
|
|
|
|
|
|
|||||||||||||||||||||||||||||||||
V145 |
#04 |
|
|
|
|
|
|
|
|
|
|||||||||||||||||||||||||||||||||
V145 |
#05 |
|
|
|
|
|
|
|
|
|
|||||||||||||||||||||||||||||||||
V145 |
#06 |
|
|
|
|
|
|
|
|
|
|||||||||||||||||||||||||||||||||
V145 |
#07 |
|
|
|
|
|
|
|
|
|
|||||||||||||||||||||||||||||||||
V145 |
#08 |
|
|
|
|
|
|
|
|
|
|||||||||||||||||||||||||||||||||
V145 |
#09 |
|
|
|
|
|
|
|
|
|
|||||||||||||||||||||||||||||||||
V145 |
#10 |
|
|
|
|
|
|
|
|
|
|||||||||||||||||||||||||||||||||
27 | 84 | 128 | 136 | 169 | 170 | 171 | 331 | 335 | 336 | 337 | 337 | 338 | 339 | 340 | 346 | 351 | 352 | 353 | 354 | ||||||||||||||||||||||||
Z04 |
#01 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||||||||||||||||
Z04 |
#02 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||||||||||||||||
Z04 |
#03 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||||||||||||||||
Z04 |
#04 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||||||||||||||||
Z04 |
#05 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||||||||||||||||
Z04 |
#06 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||||||||||||||||
Z04 |
#07 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||||||||||||||||
Z04 |
#08 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||||||||||||||||
Z04 |
#09 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||||||||||||||||
Z04 |
#10 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||||||||||||||||||||||
7 | 38 | 43 | 79 | 127 | 128 | 148 | 171 | 172 | 173 | 229 | 301 | 318 | 319 | 320 | 321 | 322 | 323 | 324 | 325 | 326 | 327 | 328 | 329 | 330 | 331 | 332 | 333 | 334 | 347 | 348 | 349 | 350 | 352 | 353 | 354 | 355 | 357 | 358 | 391 | 400 | 472 | ||
W127 |
#01 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
W127 |
#02 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
W127 |
#03 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
W127 |
#04 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
W127 |
#05 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
W127 |
#06 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
W127 |
#07 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
W127 |
#08 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
W127 |
#09 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
W127 |
#10 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Uncorrected ‘‘p’’ distance matrix of clones.
|
W136_#01 | W136_#02 | W136_#03 | W136_#04 | W136_#05 | W136_#06 | W136_#07 | W136_#08 | W136_#09 | W136_#10 |
W136_#01 | - | |||||||||
W136_#02 | 0.0019 | - | ||||||||
W136_#03 | 0.0196 | 0.0216 | - | |||||||
W136_#04 | 0.0019 | 0.0039 | 0.0177 | - | ||||||
W136_#05 | 0.0216 | 0.0236 | 0.0058 | 0.0196 | - | |||||
W136_#06 | 0.0058 | 0.0078 | 0.0176 | 0.0039 | 0.0196 | - | ||||
W136_#07 | 0.0117 | 0.0137 | 0.0157 | 0.0098 | 0.0098 | 0.0098 | - | |||
W136_#08 | 0.0182 | 0.0202 | 0.0223 | 0.0162 | 0.0202 | 0.0162 | 0.0141 | - | ||
W136_#09 | 0.0216 | 0.0236 | 0.0058 | 0.0196 | 0 | 0.0196 | 0.0098 | 0.0202 | - | |
W136_#10 | 0.0019 | 0.0039 | 0.0177 | 0 | 0.0196 | 0.0039 | 0.0098 | 0.0162 | 0.0196 | - |
|
|
|||||||||
|
W202_#01 | W202_#02 | W202_#03 | W202_#04 | W202_#05 | W202_#06 | W202_#07 | W202_#08 | W202_#09 | W202_#10 |
W202_#01 | - | |||||||||
W202_#02 | 0.0139 | - | ||||||||
W202_#03 | 0.0200 | 0.0157 | - | |||||||
W202_#04 | 0.0142 | 0.022 | 0.0140 | - | ||||||
W202_#05 | 0.0119 | 0.0059 | 0.0119 | 0.0259 | - | |||||
W202_#06 | 0.0139 | 0 | 0.0157 | 0.0219 | 0.0059 | - | ||||
W202_#07 | 0.0139 | 0 | 0.0157 | 0.0219 | 0.0059 | 0 | - | |||
W202_#08 | 0.0122 | 0.0239 | 0.0160 | 0.0061 | 0.0239 | 0.0239 | 0.0239 | - | ||
W202_#09 | 0.0119 | 0.0019 | 0.0137 | 0.0199 | 0.0078 | 0.0019 | 0.0019 | 0.0219 | - | |
W202_#10 | 0.0100 | 0.0176 | 0.0177 | 0.0080 | 0.0176 | 0.0176 | 0.0176 | 0.0060 | 0.0157 | - |
|
|
|||||||||
|
V145_#01 | V145_#02 | V145_#03 | V145_#04 | V145_#05 | V145_#06 | V145_#07 | V145_#08 | V145_#09 | V145_#10 |
V145_#01 | - | |||||||||
V145_#02 | 0.0019 | - | ||||||||
V145_#03 | 0.0078 | 0.0059 | - | |||||||
V145_#04 | 0.0078 | 0.0059 | 0 | - | ||||||
V145_#05 | 0.0059 | 0.0039 | 0.0019 | 0.0019 | - | |||||
V145_#06 | 0.0059 | 0.0059 | 0.0078 | 0.0059 | 0.0078 | - | ||||
V145_#07 | 0.0078 | 0.0098 | 0.0078 | 0.0078 | 0.0078 | 0.0137 | - | |||
V145_#08 | 0.0019 | 0 | 0.0059 | 0.0059 | 0.0039 | 0.0059 | 0.0098 | - | ||
V145_#09 | 0.0039 | 0.0019 | 0.0039 | 0.0039 | 0.0059 | 0.0019 | 0.0117 | 0.0019 | - | |
V145_#10 | 0.0059 | 0.0039 | 0.0078 | 0.0059 | 0.0078 | 0.0039 | 0.0137 | 0.0039 | 0.0019 | - |
|
|
|||||||||
|
Z704_#01 | Z704_#02 | Z704_#03 | Z704_#04 | Z704_#05 | Z704_#06 | Z704_#07 | Z704_#08 | Z704_#09 | Z704_#10 |
Z704_#01 | - | |||||||||
Z704_#02 | 0.0019 | - | ||||||||
Z704_#03 | 0.0019 | 0 | - | |||||||
Z704_#04 | 0.0019 | 0 | 0 | - | ||||||
Z704_#05 | 0.0098 | 0.0078 | 0.0078 | 0.0078 | - | |||||
Z704_#06 | 0.0098 | 0.0078 | 0.0078 | 0.0078 | 0 | - | ||||
Z704_#07 | 0.0117 | 0.0098 | 0.0098 | 0.0098 | 0.0019 | 0.0019 | - | |||
Z704_#08 | 0.0039 | 0.0019 | 0.0019 | 0.0019 | 0.0059 | 0.0059 | 0.0078 | - | ||
Z704_#09 | 0.0039 | 0.0019 | 0.0019 | 0.0019 | 0.0059 | 0.0059 | 0.0078 | 0 | - | |
Z704_#10 | 0.0141 | 0.0162 | 0.0162 | 0.0162 | 0.0162 | 0.0162 | 0.0182 | 0.0182 | 0.0182 | - |
|
|
|||||||||
|
V127_#01 | V127_#02 | V127_#03 | V127_#04 | V127_#05 | V127_#06 | V127_#07 | V127_#08 | V127_#09 | V127_#10 |
V127_#01 | - | |||||||||
V127_#02 | 0.0101 | - | ||||||||
V127_#03 | 0.0289 | 0.0307 | - | |||||||
V127_#04 | 0.0267 | 0.0328 | 0.0083 | - | ||||||
V127_#05 | 0.0122 | 0.0141 | 0.0368 | 0.0246 | - | |||||
V127_#06 | 0.0041 | 0.0101 | 0.0267 | 0.0205 | 0.0121 | - | ||||
V127_#07 | 0.0144 | 0.0246 | 0.0083 | 0.0083 | 0.0266 | 0.0185 | - | |||
V127_#08 | 0.0165 | 0.0266 | 0.0104 | 0.0104 | 0.0246 | 0.0246 | 0.0146 | - | ||
V127_#09 | 0.0226 | 0.0328 | 0.0083 | 0.0041 | 0.0287 | 0.0267 | 0.0083 | 0.0104 | - | |
V127_#10 | 0.0124 | 0.0226 | 0.0104 | 0.0104 | 0.0267 | 0.0165 | 0.0021 | 0.0167 | 0.0104 | - |
|
|
There were 11 single-base substitutions, 3 mono and 4 multi-nucleotide indels, in clones of specimen W136 (
Clones of
In Bayesian analysis 50 cloned amplicons from
Fragment of consensus Bayesian tree of the subgenus
Despite the popularity of the
Here we contribute with the first insight into the intraspecific
The
Recent works showed that tandem arrays of rRNA genes in most Lepidoteran species form one or two so-called rDNA clusters, although some exceptions in cluster number exist (
To conclude, our study demonstrates that the results of direct sequencing may not describe the actual and entire set of sequence variants. Level of divergence between clones of one individual can be comparable to interspecific genetic differences variations or even exceed them. Hence, cloning and subsequent intraindividual haplotypes handling are required for reliable phylogenetic reconstructions.
The complete financial support for this study was provided by the grant from the Russian Science Foundation no. 14-14-00541 to the Zoological Institute of Russian Academy of Sciences. We thank Boris Anokhin and Alsu Saifitdinova for help in DNA cloning. The work was partially performed using equipment of the ‘Chromas’ Core Facility and Centre for Molecular and Cell Technologies of St. Petersburg State University. Postdoctoral fellowship was provided to Nazar Shapoval from St. Petersburg State University.
Consensus Bayesian tree of the subgenus
TIFF image
Consensus Bayesian tree of the subgenus