Monograph |
|
Corresponding author: Vladimir A. Lukhtanov ( lukhtanov@mail.ru ) Academic editor: Valentina G. Kuznetsova
© 2016 Maria S. Vishnevskaya, Alsu F. Saifitdinova, Vladimir A. Lukhtanov.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Vishnevskaya MS, Saifitdinova AF, Lukhtanov VA (2016) Karyosystematics and molecular taxonomy of the anomalous blue butterflies (Lepidoptera, Lycaenidae) from the Balkan Peninsula. Comparative Cytogenetics 10(5): 1-85. https://doi.org/10.3897/CompCytogen.v10i5.10944
|
The Balkan Peninsula represents one of the hottest biodiversity spots in Europe. However, the invertebrate fauna of this region is still insufficiently investigated, even in respect of such well-studied organisms as Lepidoptera. Here we use a combination of chromosomal, molecular and morphological markers to rearrange the group of so-called anomalous blue butterflies (also known as ‘brown complex’ of the subgenus Agrodiaetus Hübner, [1822] and as the Polyommatus (Agrodiaetus) admetus (Esper, 1783) species group) and to reveal its cryptic taxonomic structure. We demonstrate that P. aroaniensis (Brown, 1976) is not as widespread in the Balkans as was previously thought. In fact, it has a dot-like distribution range restricted to the Peloponnese Peninsula in South Greece. Polyommatus orphicus Kolev, 2005 is not as closely related to the Turkish species P. dantchenkoi (Lukhtanov & Wiemers, 2003) as was supposed earlier. Instead, it is a Balkan endemic represented by two subspecies: P. orphicus orphicus (Bulgaria) and P. orphicus eleniae Coutsis & De Prins, 2005 (Northern Greece). Polyommatus ripartii (Freyer, 1830) is represented in the Balkans by an endemic subspecies P. ripartii pelopi. The traditionally recognized P. admetus (Esper, 1783) is shown to be a heterogeneous complex and is divided into Polyommatus admetus sensu stricto (the Balkans and west Turkey) and P. yeranyani (Dantchenko & Lukhtanov, 2005) (east Turkey, Armenia, Azerbaijan and Iran). Polyommatus nephohiptamenos (Brown & Coutsis, 1978) is confirmed to be a species with a dot-like distribution range in Northern Greece. Finally, from Central Greece (Timfristos and Parnassos mountains) we describe Polyommatus timfristos Lukhtanov, Vishnevskaya & Shapoval, sp. n. which differs by its haploid chromosome number (n=38) from the closely related and morphologically similar P. aroaniensis (n=47-48) and P. orphicus (n=41-42). We provide chromosomal evidence for three separate south Balkan Pleistocene refugia (Peloponnesse, Central Greece and Northern Greece/South Bulgaria) and stress the biogeographic importance of Central Greece as a place of diversification. Then we argue that the data obtained have direct implications for butterfly karyology, taxonomy, biogeography and conservation.
Agrodiaetus , biodiversity, chromosome, COI , conservation, cryptic species, DNA barcode, ITS2 , karyotype, mitochondrial marker, Polyommatus timfristos sp. n., protected species, red list
The Balkan Peninsula is recognized as a European biodiversity hotspot, with high endemism found in animals and plants (
Within Balkan Lepidoptera, the Agrodiaetus Hübner, [1822] blue butterflies are the most complicated group from the taxonomical point of view. The subgenus Agrodiaetus is a distinct monophyletic lineage within the species-rich genus Polyommatus Latreille, 1804 (
The subgenus Agrodiaetus includes numerous species, subspecies and forms with uncertain taxonomic positions (
Although this group has attracted the attention of numerous researchers (e.g.
In most cases, species identification in Agrodiaetus is extremely difficult. The morphology of male genitalia is uniform throughout most of the species and, with a few exceptions (see
Despite morphological similarity, the taxonomic and identification problems within the subgenus Agrodiaetus can be solved if chromosomal (
Molecular studies revealed that subgenus Agrodiaetus consists of 10 monophyletic clades: the P. transcaspicus (Heyne, 1895) group, the P. iphigenides (Staudinger, 1886) group, the P. ershoffii (Lederer, 1869) group, the P. poseidon (Herrich-Schäffer, 1844) group, the P. admetus group, the P. damone (Eversmann, 1841) group, the P. carmon (Herrich-Schäffer, 1851) group, the P. damon (Denis & Schiffermüller, 1775) group, the P. dolus group and the P. actis (Herrich-Schäffer, 1851) group (
Species delimitation is especially difficult within a group of so-called anomalous blue species (known also as ‘brown complex’ of the subgenus Agrodiaetus and as the Polyommatus admetus species complex). This group is composed of multiple species in which both male and female butterflies have similar brown coloration on the upperside of the wings (
The group of anomalous blue species includes taxa belonging to two clearly monophyletic and most probably sister clades: the P. admetus clade (comprises only monomorphic species – P. admetus, P. demavendi, P. khorasanensis. P. nephohiptamenos, P. ripartii, P. pseudorjabovi) and the P. dolus clade (comprises both monomorphic – P. alcestis, P. karacetinae, P. eriwanensis, P. interjectus, P. dantchenkoi, P. humedasae,P. aroaniensis, P. orphicus, P. timfristos sp. n., P. fabressei, P. violetae, P. valiabadi, P. rjabovianus; and dimorphic species – P. dolus, P. fulgens, P. menalcas). The anomalous blue butterflies represent a real stumbling block in the Agrodiaetus taxonomy (
The goal of the present study is a simultaneous investigation of chromosomal, molecular and morphological diversity in the anomalous blue butterflies from the Balkan Peninsula and interpretation of this diversity in terms of taxonomy. To achieve this goal, the following tasks were set:
To collect specimens of all the taxa of the complex described from the territory of the Balkan Peninsula. To collect specimens from different populations of these taxa.
To study their karyotypes (chromosome number and structure) using standard protocols for staining.
To obtain data on the variability of molecular markers: mitochondrial DNA barcode (COI gene fragment) and nuclear internal transcribed spacer 2 (ITS2). These markers were selected because the usefulness of mitochondrial COI barcodes in taxonomic studies on species-level is generally recognized (
To study the variability of the wing pattern characters which can be potentially useful for delimitation of species and populations (presence/reduction/absence of the white streak on the underside of the hindwings, the development of the marginal marking on the underside of the wings, presence or absence of a white stroke on the underside of the forewings).
To interpret the discovered chromosomal, molecular and morphological diversity in terms of taxonomy using two original methodologies: (1) detecting and taxonomic interpretation of cryptic entities found in sympatry and allopatry using combined analysis of mitochondrial and chromosomal markers (
Butterflies for this study were collected in 2008 in the Balkan Peninsula by V.A. Lukhtanov, N.A. Shapoval and L. Rieppel, in 2016 in Hvoyna village (Bulgaria) by E.A. Pazhenkova and in the Tigirekskiy Reservation (the Altai Mountains, Russia) by M.S.Vishnevskaya in 2007 (Fig.
Localities of the species collected for the study (the species list is presented in Table
| Traditionally accepted name and combination | Proposed name and combination | Sample code | GenBank code COI | GenBank ITS2 | Locality and date |
|---|---|---|---|---|---|
| P. admetus | P. admetus | 08D109 | KY050594 | Greece, Kalavrita, 38°02.097'N; 22°07.085'E, 812 m, 17 July 2008 | |
| P. admetus | P. admetus | 08D211 | KY050595 | KY066732 | Greece, Kalavrita 38°02.097'N; 22°07.085'E, 1150 m, 19 July 2008 |
| P. admetus | P. admetus | 08D386 | KY050596 | KY066733 | Greece, Smolikas, 40°03.175'N; 20°53.941'E, 1497 m, 22 July 2008 |
| P. admetus | P. admetus | 08D655 | KY050597 | Bulgaria, Dragoman, 42°56.320'N; 22°56.038'E, 753 m, 29 July 2008 | |
| P. aroaniensis | P. aroaniensis | 08D102 | KY050598 | KY066734 | Greece, Kalavrita, 38°00.699'N; 22°11.554'E, 1640, 16 July 2008 |
| P. aroaniensis | P. timfristos | 08D205 | KY066724 | KY081278 | Greece, Parnassos, 38°33.311'N; 22°34.300'E, 1750m, 19 July 2008 |
| P. aroaniensis | P. timfristos | 08D247 | KY066725 | KY081279 | Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008 |
| P. aroaniensis | P. timfristos | 08D255 | KY066726 | KY081280 | Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008 |
| P. aroaniensis | P. timfristos | 08D258 | KY066727 | KY081281 | Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008 |
| P. aroaniensis | P. timfristos | 08D273 | KY066728 | KY081282 | Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008 |
| P. aroaniensis | P. timfristos | 08D274 | KY066729 | KY081283 | Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008 |
| P. dantchenkoi orphicus | P. orphicus orphicus | 08D546 | KY066698 | KY081246 | Bulgaria, Hvoyna, Rodopi Mts, 41°52'14"N; 24°41'6"E, 800 m, 26 July 2008 |
| P. dantchenkoi orphicus | P. orphicus orphicus | 08D560 | KY066699 | KY081247 | Bulgaria, Hvoyna, Rodopi Mts, 41°52'14"N; 24°41'6"E, 800 m, 26 July 2008 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 002 | KY066700 | KY081266 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 003 | KY066701 | KY081267 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 006 | KY066702 | KY081268 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 010 | KY066705 | KY081271 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 011 | KY066706 | KY081272 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 012 | KY066707 | KY081273 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 013 | KY066708 | KY081274 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 014 | KY066709 | KY081275 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 015 | KY066710 | KY081276 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 016 | KY066711 | KY081277 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 007 | KY066703 | KY081269 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | PE 008 | KY066704 | KY081270 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016 |
| P. dantchenkoi orphicus | P. orphicus orphicus | 08D545 | KY066697 | KY081245 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 800 m, 26 July 2008 |
| P. eleniae | P. orphicus eleniae | 08D431 | KY050599 | KY066735 | Greece, Granitis, 41°17.543'N; 23°56.265'E, 830 m, 23 July 2008 |
| P. eleniae | P. orphicus eleniae | 08D433 | KY050600 | KY066736 | Greece, Granitis, 41°17.543'N; 23°56.265'E, 830 m, 23 July 2008 |
| P. eleniae | P. orphicus eleniae | 08D434 | KY050601 | KY081243 | Greece, Granitis, 41°17.543'N; 23°56.265'E, 830 m, 23 July 2008 |
| P. eleniae | P. orphicus eleniae | 08D437 | KY050602 | KY081244 | Greece, Granitis, 41°17.543'N; 23°56.265'E, 830 m, 23 July 2008 |
| P. nephohiptamenos | P. nephohiptamenos | 08D471 | KY050603 | KY081248 | Greece, Granitis, 41°17.543'N; 23°56.265'E, 830 m, 23 July 2008 |
| P. nephohiptamenos | P. nephohiptamenos | 08D483 | KY050604 | KY081249 | Greece, Granitis, 41°13.485'N; 24°02.990'E, 1646 m, 23 July 2008 |
| P. nephohiptamenos | P. nephohiptamenos | 08D485 | Greece, Granitis, 41°13.485'N; 24°02.990'E 1646 m, 23 July 2008 | ||
| P. nephohiptamenos | P. nephohiptamenos | 08D494 | KY050605 | KY081250 | Greece, Granitis, 41°13.485'N; 24°02.990'E, 1450–1750 m, 24 July 2008 |
| P. nephohiptamenos | P. nephohiptamenos | 08D496 | KY050606 | KY081251 | Greece, Granitis, 41°13.485'N; 24°02.990'E, 1450–1750 m, 24 July 2008 |
| P. nephohiptamenos | P. nephohiptamenos | 08D498 | KY066694 | KY081252 | Greece, Granitis, 41°13.485'N; 24°02.990'E, 1450–1750 m, 24 July 2008 |
| P. nephohiptamenos | P. nephohiptamenos | 08D499 | KY066695 | KY081253 | Greece, Granitis, 41°13.485'N; 24°02.990'E, 1450–1750 m, 24 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | 08D249 | KY066717 | KY081258 | Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | 08D252 | KY066718 | KY081259 | Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | 08D257 | KY066719 | KY081260 | Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | 08D260 | KY066720 | KY081263 | Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | 08D291 | KY066721 | KY081261 | Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | 08D549 | KY066722 | KY081262 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 800 m |
| P. ripartii pelopi | P. ripartii pelopi | 08D551 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 800m, 26 July 2008 | ||
| P. ripartii pelopi | P. ripartii pelopi | 08D571 | KY066723 | KY081264 | Bulgaria, Hvoyna, Rodopi Mts yna, 41°52.14'N; 24°41.6'E, 800 m, 26 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | 08D085 | KY066712 | KY081254 | Greece, Kalavrita, 38°02.097'N; 22°07.085'E, 812 m, 16 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | 08D092 | KY066713 | KY081255 | Greece, Kalavrita, 38°02.097'N; 22°07.085'E, 812 m, 16 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | 08D120 | KY066714 | KY081256 | Greece Kalavrita, 38°02.097'N; 22°07.085'E, 812 m, 17 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | 08D144 | KY066715 | KY085933 | Greece Kalavrita, 38°01.617'N; 22°13.411'E, 1610–1700 m, 17 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | 08D145 | KY066716 | KY081257 | Greece, Kalavrita, 38°01.617'N; 22°13.411'E 1610–1700 m, 17 July 2008 |
| P. ripartii pelopi | P. ripartii pelopi | PE 009 | KY066696 | KY081265 | Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N 24°41.6'E, 950 m |
| P. damon | P. damon | VM237 | KY066730 | Russia, Altai Mts, Tigirek, 51°0'N; 82°55'E, 28 July 2007 | |
| P. damon | P. damon | VM196 | KY066731 | Russia, Altai Mts, Tigirek, 51°0'N; 82°55'E, 19 July 2007 |
Before processing butterflies were put in glassine envelopes and kept alive for less than one hour. Testes were removed and put into a vial with a fresh fixative (3:1, 96% ethanol: glacial acetic acid). The wings were removed and put into a glassine envelope, and the body was placed into a vial with 96% ethanol for further molecular analysis. All chromosome preparations, butterfly bodies in ethanol and wings in glassine envelopes are stored in the Department of Karyosystematics (Zoological Institute of the Russian Academy of Sciences, St. Petersburg).
Testes were stored in the 3:1 fixative for several months at +4 °C and then stained with 2% acetic orcein for 30 days at 20 °C. We used a two-phase method of chromosome analysis following
We used a 657-bp fragment within the mitochondrial COI gene and a 440-bp fragment within the ITS2 region. DNA was extracted using phenol-chloroform method according to the standard protocol (
For COI amplification we used the self-designed primers COIF1 (5’-CCACAAATCATAAAGATATTGGAAC-3’) and COIR1 (5’-TGATGAGCTCATACAATAAATCCTA-3’). For ITS2 amplification we used the self-designed primers ITS2F (5’-CATATGCCACACTGTTCGTCTG-3’) and ITS2R (5’-GATATCCGTCAGCGCAACG-3’).
The polymerase chain reaction (PCR) was carried out with Taq-polymerase (Sileks) in 20 µl of PCR buffer containing MgCl2 [2.5 mM], dNTP [200 mM] and forward and reverse primers [20 pmol each]. Amplification of COI gene fragment was carried out with the following conditions: initial denaturation at 94 °C for 3 min, followed by 30 cycles of 30 sec at 94 °C, 30 sec at 51 °C (the annealing temperature) and 30 sec at 72 °C, and then final elongation 5 min for 72 °C. Amplification of ITS2 region fragment was carried out with the following conditions: initial denaturation at 94 °C for 2 min, followed by 30 cycles of 30 sec at 94 °C, 30 sec at 60 °C (the annealing temperature) and 30 sec at 72 °C, and then final elongation 5 min for 72 °C.
After amplification, PCR mix was loaded in 1% agarose gel and specific product was separated by gel electrophoresis (Fig.
All the preparations for sequencing were held in “The Laboratory of Animal Genetics” of Saint-Petersburg State University and “Chromas” Core Facility, Saint-Petersburg State University Research Park. Sequencing was carried out in the Research Resource Center for Molecular and Cell Technologies. GenBank codes of the studied samples are provided in Tables
| Taxon and field code | COI GenBank code | ITS2 GenBank code | COI haplogroup |
|---|---|---|---|
| P. admetus 08D109 | KY050594 | ad_1 | |
| P. admetus 08D211 | KY050595 | KY066732 | ad_2 |
| P. admetus 08D386 | KY050596 | KY066733 | ad_3 |
| P. admetus | AY556867 | AY556733 | ad_4 |
| P. admetus | AY556986 | ad_5 | |
| P. admetus | KC581753 | ad_6 | |
| P. admetus | KC581754 | ad_7 | |
| P. alcestis alcestis | AY557008 | AY556641 | alc_3 |
| P. aroaniensis 08D102 | KY050598 | KY066734 | ar_1 |
| P. aroaniensis | AY556856 | AY556725 | ar_2 |
| P. dantchenkoi | AY557072 | AY556678 | dan_1 |
| P. dantchenkoi | AY557081 | AY556685 | |
| P. dantchenkoi | AY557073 | AY556679 | |
| P. demavendi belovi | KR265493 | dem_1 | |
| P. demavendi belovi | KR265494 | dem_2 | |
| P. demavendi belovi | EF104630 | dem_3 | |
| P. demavendi lorestanus | AY557142 | AY556743 | dem_4 |
| P. dolus virgilius | HM210162 | HM210180 | dol_1 |
| P. dolus vittatus | AY496740 | dol_2 | |
| P. fabressei | AY496744 | fab_1 | |
| P. fabressei | AY556952 | AY556608 | |
| P. fabressei | AY556869 | AY556734 | fab_1 |
| P. fulgens | AY556941 | AY556601 | |
| P. fabressei | EF104605 | HM210186 | fab_4 |
| P. fulgens | AY556963 | AY556615 | ful_1 |
| P. fulgens | AY496746 | ||
| P. fulgens | AY496712 | ||
| P. fulgens | AY556954 | AY556610 | ful_2 |
| P. fulgens | AY556958 | ful_4 | |
| P. humedasae | AY557127 | AY556710 | hum_1 |
| P. humedasae | AY557128 | AY556711 | hum_2 |
| P. humedasae | HM210169 | HM210192 | |
| P. humedasae | HM210170 | HM210193 | hum_4 |
| P. karacetinae | AY556906 | alc_1 | |
| P. karacetinae | AY556907 | AY556574 | alc_1 |
| P. karacetinae | AY557090 | alc_4 | |
| P. karacetinae urmiaensis | EF104631 | urm | |
| P. khorasanensis | AY557138 | AY556737 | khor |
| P. menalcas | AY556982 | men_1 | |
| P. menalcas | AY557111 | men_2 | |
| P. menalcas | AY557001 | AY556635 | men_3 |
| P. nephohiptamenos 08D471 | KY050603 | KY081248 | ne_1 |
| P. nephohiptamenos 08D483 | KY050604 | KY081249 | |
| P. nephohiptamenos 08D499 | KY066695 | KY081253 | |
| P. nephohiptamenos 08D496 | KY050606 | KY081251 | |
| P. nephohiptamenos 08D494 | KY050605 | KY081250 | ne_3 |
| P. nephohiptamenos 08D498 | KY066694 | KY081252 | ne_5 |
| P. nephohiptamenos | KC581745 | ne_7 | |
| P. nephohiptamenos | AY556860 | ||
| P. nephohiptamenos | AY556859 | AY556728 | |
| P. orphicus eleniae 08D431 | KY050599 | KY066735 | orph_1 |
| P. orphicus eleniae 08D433 | KY050600 | KY066736 | |
| P. orphicus eleniae 08D437 | KY050602 | KY081244 | |
| P. orphicus eleniae 08D434 | KY050601 | KY081243 | orph_3 |
| P. orphicus orphicus 08D545 | KY066697 | KY081245 | orph_5 |
| P. orphicus orphicus 08D560 | KY066699 | KY081247 | |
| P. orphicus orphicus PE 003 | KY066701 | KY081267 | orph_5 |
| P. orphicus orphicus PE 011 | KY066706 | KY081272 | |
| P. orphicus orphicus PE 013 | KY066708 | KY081274 | |
| P. orphicus orphicus PE 014 | KY066709 | KY081275 | |
| P. orphicus orphicus PE 015 | KY066710 | KY081276 | |
| P. orphicus orphicus PE 007 | KY066703 | KY081269 | |
| P. orphicus orphicus PE 006 | KY066702 | KY081268 | |
| P. orphicus orphicus PE 012 | KY066707 | KY081273 | orph_6 |
| P. orphicus orphicus PE 008 | KY066704 | KY081270 | |
| P. orphicus orphicus 08D546 | KY066698 | KY081246 | |
| P. orphicus orphicus PE 002 | KY066700 | KY081266 | orph_8 |
| P. orphicus orphicus PE 010 | KY066705 | KY081271 | orph_11 |
| P. orphicus orphicus PE 016 | KY066711 | KY081277 | |
| P. pseudorjabovi | KR265487 | pse_1 | |
| P. pseudorjabovi | KR265489 | ||
| P. pseudorjabovi | KR265490 | ||
| P. pseudorjabovi | KR265491 | pse_1 | |
| P. pseudorjabovi | KR265484 | ||
| P. pseudorjabovi | KR265480 | ||
| P. pseudorjabovi | KR265496 | pse_2 | |
| P. pseudorjabovi | KR265483 | ||
| P. pseudorjabovi | KR265481 | ||
| P. pseudorjabovi | KR265488 | pse_3 | |
| P. pseudorjabovi | KR265482 | pse_9 | |
| P. pseudorjabovi | KR265500 | pse_12 | |
| P. ripartii pelopi 08D249 | KY066717 | KY081258 | rip_1 |
| P. ripartii pelopi 08D252 | KY066718 | KY081259 | |
| P. ripartii pelopi 08D257 | KY066719 | KY081260 | rip_3 |
| P. ripartii pelopi 08D260 | KY066720 | KY081263 | rip_4 |
| P. ripartii pelopi 08D291 | KY066721 | KY081261 | |
| P. ripartii pelopi 08D549 | KY066722 | KY081262 | |
| P. ripartii pelopi 08D085 | KY066712 | KY081254 | |
| P. ripartii pelopi 08D145 | KY066716 | KY081257 | |
| P. ripartii ripartii | AY556858 | AY556727 | |
| P. ripartii ripartii | KC581746 | ||
| P. ripartii ripartii | KC581747 | ||
| P. ripartii ripartii | KC581748 | ||
| P. ripartii ripartii | KC581749 | ||
| P. ripartii ripartii | KC581750 | ||
| P. ripartii ripartii | KC581751 | ||
| P. ripartii ripartii | KC581752 | ||
| P. ripartii pelopi 08D571 | KY066723 | KY081264 | |
| P. ripartii paralcestis | KC581715 | rip_8 | |
| P. ripartii paralcestis | KC581716 | rip_9 | |
| P. ripartii pelopi | AY557042 | rip_10 | |
| P. ripartii pelopi 08D092 | KY066713 | KY081255 | rip_12 |
| P. ripartii pelopi 08D120 | KY066714 | KY081256 | rip_13 |
| P. ripartii pelopi 08D144 | KY066715 | KY085933 | rip_14 |
| P. ripartii pelopi PE 009 | KY066696 | KY081265 | rip_82 |
| P. ripartii ripartii | HM210164 | rip_16 | |
| P. ripartii ripartii | HM210172 | ||
| P. ripartii riparii | HM210163 | HM210197 | |
| P. ripartii ripartii | AY556944 | AY556603 | rip_18 |
| P. ripartii ripartii | KC581717 | rip_19 | |
| P. ripartii ripartii | KC581718 | ||
| P. ripartii ripartii | AY556957 | ||
| P. ripartii ripartii | AY556962 | rip_20 | |
| P. ripartii ripartii | EF104603 | rip_21 | |
| P. ripartii ripartii | FJ663243 | rip_22 | |
| P. ripartii ripartii | FJ663244 | rip_23 | |
| P. ripartii ripartii | FJ663245 | ||
| P. ripartii ripartii | FJ663246 | ||
| P. ripartii ripartii | JN276883 | rip_26 | |
| P. ripartii ripartii | GU675760 | ||
| P. ripartii ripartii | GU676039 | rip_27 | |
| P. ripartii ripartii | GU676152 | ||
| P. ripartii ripartii | GU677012 | ||
| P. ripartii ripartii | GU677029 | ||
| P. ripartii ripartii | HM901559 | ||
| P. ripartii ripartii | HM901664 | ||
| P. ripartii ripartii | KC581736 | ||
| P. ripartii ripartii | KC581737 | ||
| P. ripartii ripartii | KC581738 | ||
| P. ripartii ripartii | KC581739 | ||
| P. ripartii ripartii | KC581740 | ||
| P. ripartii ripartii | GU676158 | ||
| P. ripartii ripartii | GU676213 | rip_30 | |
| P. ripartii ripartii | KC617793 | rip_31 | |
| P. ripartii ripartii | KC617794 | ||
| P. ripartii ripartii | GU676220 | rip_31 | |
| P. ripartii ripartii | HM210167 | rip_35 | |
| P. ripartii ripartii | KC581741 | rip_36 | |
| P. ripartii ripartii | KC581742 | ||
| P. ripartii ripartii | KC581743 | ||
| P. ripartii ripartii | HM210168 | ||
| P. ripartii ripartii | KC581723 | rip_37 | |
| P. ripartii ripartii | KC581724 | ||
| P. ripartii ripartii | KC581725 | ||
| P. ripartii ripartii | HM210171 | ||
| P. ripartii ripartii | KC567885 | rip_42 | |
| P. ripartii ripartii | KC581719 | ||
| P. ripartii ripartii | KC567883 | ||
| P. ripartii ripartii | KC567884 | rip_43 | |
| P. ripartii ripartii | KC581720 | rip_48 | |
| P. ripartii ripartii | KC581721 | rip_49 | |
| P. ripartii ripartii | KC581722 | rip_50 | |
| P. ripartii ripartii | KC581726 | rip_54 | |
| P. ripartii ripartii | KC581727 | rip_55 | |
| P. ripartii ripartii | KC581728 | ||
| P. ripartii ripartii | KC581729 | rip_57 | |
| P. ripartii ripartii | KC581730 | ||
| P. ripartii ripartii | KC581731 | ||
| P. ripartii ripartii | KC581732 | ||
| P. ripartii ripartii | KC581733 | ||
| P. ripartii ripartii | KC581734 | rip_62 | |
| P. ripartii ripartii | KC581735 | ||
| P. ripartii ripartii | KC581744 | rip_72 | |
| P. rjabovianus rjabovianus | KR265475 | rja_1 | |
| P. rjabovianus rjabovianus | KR265476 | ||
| P. rjabovianus rjabovianus 2014A10 | |||
| P. rjabovianus rjabovianus | KR265477 | ||
| P. rjabovianus masul | KR265497 | rja_4 | |
| P. rjabovianus masul | KR265485 | ||
| P. rjabovianus masul | KR265498 | ||
| P. rjabovianus masul | AY954006 | ||
| P. rjabovianus masul | KR265499 | ||
| P. rjabovianus rjabovianus | KR265478 | rja_5 | |
| P. rjabovianus rjabovianus | AY954019 | ||
| P. timfristos 08D205 | KY066724 | KY081278 | tim_1 |
| P. timfristos 08D247 Holotype | KY066725 | KY081279 | tim_2 |
| P. timfristos 08D273 | KY066728 | KY081282 | |
| P. timfristos 08D274 | KY066729 | KY081283 | |
| P. timfristos 08D255 | KY066726 | KY081280 | |
| P. timfristos 08D258 | KY066727 | KY081281 | tim_4 |
| P. valiabadi | KR265495 | val_1 | |
| P. valiabadi | KR265486 | ||
| P. valiabadi | AY556934 | AY556594 | |
| P. valiabadi | AY556882 | AY556557 | |
| P. violetae subbaeticus | EF104604 | HM210188 | viol_1 |
| P. violetae subbaeticus | HM210166 | HM210187 | viol_2 |
| P. violetae violetae | HM210173 | HM210200 | viol_3 |
| P. violetae violetae | HM210174 | HM210201 | |
| P. violetae violetae | HM210175 | HM210202 | viol_5 |
| P. yeranyani malyevi | KJ906515 | ad_8 | |
| P. yeranyani yeranyani | KR265492 | ad_9 |
The analysis involved 221 COI sequences (169 GenBank sequences and 52 own material) and 117 ITS2 sequences (66 GenBank and 51 own data).
Sequences of different length (from 415 to 657 bp in case of COI and from 415 to 440 bp in case of ITS2) were included into the final dataset alignment. We used BioEdit 7.2.5 software (
Previously, no significant conflict was detected between the mitochondrial COI and nuclear ITS2Agrodiaetus data sets (
Phylogenetic relationships were inferred using Bayesian Inference (BI), maximum likelihood (ML) and maximum parsimony (MP) analyses. jModelTest was used to determine optimal substitution models for ML inference (
Bayesian analyses were conducted using MrBayes, version 3.2 (
The ML trees were inferred using MEGA6 under the GTR+G+I model. MP analysis was performed using a heuristic search as implemented in MEGA6 (
Median network was constructed using the program Network 4.6.1.3. (Fluxus Technology, fluxus-engineering.com), with the Median Joining algorithm (
Table
| Code | Species | Chomosome number | Country | Locality | Elevation | Date |
|---|---|---|---|---|---|---|
| LR08D109 | P. admetus | n=80 | Greece (South) | Mt. Chelmos (Aroania), Kalavrita, 38°02.097'N; 22°07.085'E | 812m | 2008.VII.17 |
| LR08D211 | P. admetus | n=80 | Greece (Central) | Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E | 1267m | 2008.VII.20 |
| LR08D386 | P. admetus | n=caca80 | Greece | Smolikas Mt, Pades, 40°03.175'N; 20°53.941'E | 1497m | 2008.VII.22 |
| LR08D655 | P. admetus | n=ca80 | Bulgaria | Dragoman, 42°56.320'N; 22°56.038'E | 753m | 2008.VII.29 |
| LR08D085 | P. ripartii pelopi | 2n=ca180 | Greece (South) | Mt. Chelmos (Aroania), Kalavrita, 38°02.097'N; 22°07.085'E | 812m | 2008.VII.16 |
| LR08D092 | P. ripartii pelopi | n=90 | Greece (South) | Mt. Chelmos (Aroania), Kalavrita, 38°02.097'N; 22°07.085'E | 812m | 2008.VII.16 |
| LR08D120 | P. ripartii pelopi | 2n=ca180 | Greece (South) | Mt. Chelmos (Aroania), Kalavrita, 38°02.097'N; 22°07.085'E | 812m | 2008.VII.17 |
| LR08D144 | P. ripartii pelopi | n=90 | Greece (South) | Mt. Chelmos (Aroania), Kalavrita, 38°01.617'N; 22°13.411'E | 1610–1700m | 2008.VII.17 |
| LR08D145 | P. ripartii pelopi | n=90 | Greece (South) | Mt. Chelmos (Aroania), Kalavrita, 38°01.617'N; 22°13.411'E | 1610–1700m | 2008.VII.17 |
| LR08D249 | P. ripartii pelopi | n=90 | Greece (Central) | Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E | 1267m | 2008.VII.20 |
| LR08D252 | P. ripartii pelopi | n=ca90 | Greece (Central) | Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E | 1267m | 2008.VII.20 |
| LR08D257 | P. ripartii pelopi | n=90 | Greece (Central) | Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E | 1267m | 2008.VII.20 |
| LR08D260 | P. ripartii pelopi | 2n=ca180 | Greece (Central) | Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E | 1267m | 2008.VII.20 |
| LR08D291 | P. ripartii pelopi | n=ca90 | Greece (Central) | Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E | 1267m | 2008.VII.20 |
| LR08D549 | P. ripartii pelopi | n=ca90 | Bulgaria | Rodopi Mts, Hvoyna, 41°15'N; 24°32'E | 800m | 2008.VII.26 |
| LR08D571 | P. ripartii pelopi | n=90 | Bulgaria | Rodopi Mts, Hvoyna, 41°15'N; 24°32'E | 800m | 2008.VII.26 |
| LR08D562 | P. ripartii pelopi | n=90 | Bulgaria | Rodopi Mts, Hvoyna, 41°15'N; 24°32'E | 800m | 2008.VII.26 |
| LR08D471 | P. nephohiptamenos | n=90 | Greece (North) | Granitis, 41°17.543'N; 23°56.265'E | 830m | 2008.VII.23 |
| LR08D483 | P. nephohiptamenos | n=ca90 | Greece (Northern) | Falakro Mt, 41°13.485'N; 24°02.990'E | 1646m | 2008.VII.23 |
| LR08D485 | P. nephohiptamenos | n=ca90 | Greece (North) | Falakro Mt, 41°13.485'N; 24°02.990'E | 1646m | 2008.VII.23 |
| LR08D494 | P. nephohiptamenos | n=90 | Greece (North) | Falakro Mt, 41°13.485'N; 24°02.990'E | 1450–1750m | 2008.VII.24 |
| LR08D496 | P. nephohiptamenos | n=ca90 | Greece (North) | Falakro Mt, 41°13.485'N; 24°02.990'E | 1450–1750m | 2008.VII.24 |
| LR08D498 | P. nephohiptamenos | n=ca90 | Greece (North) | Falakro Mt, 41°13.485'N; 24°02.990'E | 1450–1750m | 2008.VII.24 |
| LR08D102 | P. aroaniensis | n=47 | Greece (South) | Mt. Chelmos (Aroania), Kalavrita, 38°00.699'N; 22°11.554'E | 1640m | 2008.VII.16 |
| LR08D247 Holotype | P. timfristos | n=38 | Greece (Central) | Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E | 1267m | 2008.VII.20 |
| LR08D255 | P. timfristos | n=38 | Greece (Central) | Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E | 1267m | 2008.VII.20 |
| LR08D258 | P. timfristos | n=38 | Greece (Central) | Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E | 1267m | 2008.VII.20 |
| LR08D273 | P. timfristos | n=38 | Greece (Central) | Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E | 1267m | 2008.VII.20 |
| LR08D274 | P. timfristos | n=38 | Greece (Central) | Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E | 1267m | 2008.VII.20 |
| LR08D205 | P. timfristos | n=38 | Greece (Central) | Parnassos Mt, 38°33.311'N; 22°34.300'E | 1750m | 2008.VII.19 |
| LR08D545 | P. orphicus orphicus | n=ca41–42 | Bulgaria | Rodopi Mts, Hvoyna, 41°15'N; 24°32'E | 800m | 2008.VII.26 |
| LR08D546 | P. orphicus orphicus | n=ca41–42 | Bulgaria | Rodopi Mts, Hvoyna, 41°15'N; 24°32'E | 800m | 2008.VII.26 |
| LR08D560 | P. orphicus orphicus | n=41, n=42 | Bulgaria | Rodopi Mts, Hvoyna, 41°15'N; 24°32'E | 800m | 2008.VII.26 |
| LR08D561 | P. orphicus orphicus | n=41, n=42 | Bulgaria | Rodopi Mts, Hvoyna, 41°15'N; 24°32'E | 800m | 2008.VII.26 |
| LR08D431 | P. orphicus eleniae | n=42 | Greece (North) | Granitis, 41°17.543'N; 23°56.265'E | 830m | 2008.VII.23 |
| LR08D433 | P. orphicus eleniae | n=41, n=42 | Greece (North) | Granitis, 41°17.543'N; 23°56.265'E | 830m | 2008.VII.23 |
| LR08D434 | P. orphicus eleniae | n=ca42 | Greece (North) | Granitis, 41°17.543'N; 23°56.265'E | 830m | 2008.VII.23 |
| LR08D437 | P. orphicus eleniae | n=ca42 | Greece (North) | Granitis, 41°17.543'N; 23°56.265'E | 830m | 2008.VII.23 |
Fig.
The haploid chromosome number n=80 was found in MI and MII cells of two studied individuals from South and Central Greece. In two specimens (Greece, Smolikas Mt and Bulgaria) we counted approximately n=ca80 at MI. The last count was performed with an approximation due to the overlapping of some bivalents. The karyotype displayed one larger bivalent in the centre of the MI plate and one larger univalent in the centre of the MII plate.
Polyommatus (Agrodiaetus) karyotypes. Bar =10 µ. a–b P. admetus, sample LR08D109, Greece, MI, n=80. One large bivalent in the centre of the plate can be seen c P. admetus, sample LR08D109, Greece, MII, n=80. One large chromosome in the centre of the plate can be seen d P. ripartii pelopi, sample LR08D249, Greece, MI, n=90. Two large bivalents in the centre of the plate can be seen e P. ripartii pelopi, sample LR08D144, Greece, MI, n=90. Two large bivalents in the centre of the plate can be seen f P. ripartii pelopi, sample LR08D145, Greece, MI, n=90. Two large bivalents in the centre of the plate can be seen g P. ripartii pelopi, sample LR08D92, Greece, MII, n=90. Two large chromosomes in the centre of the plate can be seen h P. nephohiptamenos, sample LR08D494, Northern Greece, MI, n=90. All the bivalents are situated in a plane with the largest elements in the centre of the circular metaphase plate. Bivalents are clearly separated from each other by gaps. Two bivalents are larger than the rest. i P. aroaniensis, sample LR08D102, Greece, MI, n=47.
Fig.
The haploid chromosome number was determined to be n=90 in MI and MII cells of seven studied individuals from different localities (Greece, Bulgaria). At MI, two bivalents were especially large and were situated in the centre of the metaphase plates. Bivalent 1 was 1.4–1.6 times larger than bivalent 2. The sizes of the remaining 88 bivalents decreased more or less linearly. At MII, two univalents were especially large and were situated in the centre of the metaphase plates. Chromosome 1 was 1.4–1.6 times larger than chromosome 2. The sizes of the remaining 88 chromosomes decreased more or less linearly. In three specimens we counted approximately n=ca 90 at MI. The last count was an approximation due to the overlapping of some bivalents. In three specimens, the diploid chromosome number was estimated as 2n=ca180 in male asynaptic meiosis.
Fig.
The haploid chromosome number was determined to be n=90 in MI and MII cells of two studied individuals. At MI, two bivalents (one big and one medium-sized) were larger than the others. At MII, two univalents (one big and one medium-sized) were larger than the rest. The sizes of the remaining 88 bivalents and univalents decreased more or less linearly. In four specimens we counted approximately n=ca90 at MI. The last count was an approximation due to the overlapping of some bivalents.
Fig.
In the single studied specimen collected in the type locality (Greece, Mt. Chelmos) haploid chromosome number n=47 was found in MI cells. Bivalents were fairly well differentiated with respect to their size. However, it was difficult to subdivide them objectively into size groups because the sizes of the 47 bivalents decrease more or less linearly.
Figs
The haploid chromosome number was determined to be n=38 in prometaphase, MI and MII cells of the holotype and six studied paratypes. Bivalents at MI and prometaphase and univalents at MII were fairly well differentiated with respect to their size; however, it was difficult to subdivide them objectively into size groups because the sizes of the 47 elements decrease more or less linearly.
Polyommatus (Agrodiaetus) timfristos karyotypes. Bar = 10 µ. a P. timfristos, sample LR08D205, Central Greece, Parnassos, first prometaphase of meiosis, n=38 b P. timfristos, sample LR08D205, Central Greece, Parnassos, MI, n=38 c P. timfristos, holotype, sample LR08D247, Central Greece, Timfristos, MI, n=38 d P. timfristos, sample LR08D255, Central Greece, Timfristos, MI, n=38 e P. timfristos, sample LR08D258, Central Greece, Timfristos, MI, n=38 f P. timfristos, sample LR08D258, Central Greece, Timfristos, MI, n=38 g P. timfristos, sample LR08D273, Central Greece, Timfristos, MI, n=38 h P. timfristos, sample LR08D274, Central Greece, Timfristos, MII, n=38.
Polyommatus (Agrodiaetus) karyotypes. Bar = 10 µ. a P. timfristos, sample LR08D205, Central Greece, Parnassos, MII, n=38 b P. timfristos, sample LR08D205, Central Greece, Parnassos, MII, n=38 c P. timfristos, sample LR08D205, Central Greece, Parnassos, MII, n=38 d P. timfristos, sample LR08D258, Central Greece, Timfristos, MII, n=38 e P. orphicus eleniae, sample LR08D433, Northern Greece, MI, n=41 f P. orphicus eleniae, sample LR08D431, Northern Greece, MI, n=42 g P. orphicus eleniae, sample LR08D431, Northern Greece, MI, n=ca42 h P. orphicus eleniae, sample LR08D437, Northern Greece, MII, n=41 i P. orphicus eleniae, sample LR08D437, Northern Greece, MII, n=41 j P. orphicus eleniae, sample LR08D431, Northern Greece, MII, n=42.
Two different haploid chromosome numbers (n=41 and n=42) were observed in MI and MII cells of the four specimens studied. This variation was most likely caused by polymorphism for one chromosome fussion/fission. This polymorphism resulted in three types of MI karyotype: n=41 (homozygous for chromosomal fusion/fission, one pair of fused chromosomes), n=42 (homozygous for chromosomal fusion/fission, two pairs of unfused chromosomes) and n=41 (heterozygous for chromosomal fusion/fission, 40 bivalents and one trivalent). Bivalents at MI and univalents at MII were fairly well differentiated with respect to their size; however, it was difficult to subdivide them objectively into size groups because the sizes of the elements decrease more or less linearly.
Fig.
Chromosome numbers (n=41 and n=42) were observed in MI and MII cells of the four specimens studied. This variation was most likely caused by polymorphism for one chromosome fussion/fission. This polymorphism resulted in three types of MI karyotype: n=41 (homozygous for chromosomal fusion/fission, one pair of fused chromosomes), n=42 (homozygous for chromosomal fusion/fission, two pairs of unfused chromosomes) and n=41 (heterozygous for chromosomal fusion/fission, 40 bivalents and one trivalent). Bivalents and univalents were fairly well differentiated with respect to their size; however, it was difficult to subdivide them objectively into size groups because the sizes of the elements decrease more or less linearly.
Bayesian analysis of the 657-bp region of COI gene resulted in a phylogram, showing a high level of posterior probability for the majority of the revealed clades. Analysis of the 221-specimen dataset recovered the P. admetus and P. dolus species groups as distinct monophyletic lineages. This is consistent with the previous conclusions (
Fragment of the Bayesian tree of P. admetus and P. dolus complexes based on analysis of COI barcodes and focused on P. nephohiptamenos, P. admetus and P. ripartii pelopi. Polyommatus pseudorjabovi clade is not shown in details, for its composition see
Fragment of the Bayesian tree of P. admetus and P. dolus complexes based on analysis of COI barcodes and focused on details of the West-European and the “mixed” (Eurasian) clades of P. ripartii. Numbers at nodes indicate Bayesian posterior probability.
Fragment of the Bayesian tree based on analysis of COI barcodes and focused on details of the P. dolus group. Polyommatus rjabovianus and P. valiabadi clades are not shown in details, for their composition see
Within the P. admetus group, the species P. ripartii appeared as a polyphyletic assemblage consisting of four monophyletic lineages: the “Balkan” clade, including specimens from Greece and Bulgaria, “West-European” clade, including butterflies from France, Italy and Spain, “mixed” (or Eurasian) clade, including butterflies distributed from Spain to Mongolia, and Turkish-Transcaucasian clade, including butterflies from Turkey and Armenia. The last clade formed an independent lineage, sister to the species P. demavendi (Pfeiffer, 1938) from east Turkey, Transcaususus and Iran.
P. admetus sensu auctorum formed two independent clades: one consisting of European and west Turkish specimens and another consisting of specimens from east Turkey, Armenia and Azerbaijan. Polyommatus nephohiptamenos appeared on the Bayesian tree as a paraphyletic group consisting of nine weakly differentiated individuals. On the MP and ML trees (Figs
The P. dolus group is interesting for its Balkan species position. P. aroaniensis formed an independent clade separate from P. timfristos sp. n., which formed a monophyletic clade as well. Specimens of P. orphicus orphicus and P. orphicus eleniae were closely related and formed together a paraphyletic cluster.
Because of low variability, it was difficult to use ITS2 as a single marker to construct the phylogeny of Agrodiaetus. Therefore, we decided to combine the sequence data on COI and ITS2 and constructed a tree on the base of these two markers (Fig.
Bayesian tree of P. admetus and P. dolus complexes based on analysis of concatenated alignment (COI+ITS2). Numbers at nodes indicate Bayesian posterior probability
The complicated relationships between species of P. admetus and P. dolus groups were also reflected by a haplotype network (Figs
Haplotype network of P. admetus species group. Colored circles represent different taxa. Each line segment represents a mutation step, and white small circles represent “missing” haplotypes.
Haplotype network of P. dolus species group. Colored circles represent different taxa. Each line segment represents a mutation step, and white small circles represent “missing” haplotypes.
Polyommatus ripartii was represented by 82 specimens divided in 38 haplotypes and four haplogroups which corresponded completely with the four clades revealed on the Bayesian tree (Fig.
As a by-product of our study, we also discovered that within our samples P. demavendi comprised two haplogroups. One haplogroup was represented by specimens of P. demavendi belovi, whilst the other was represented by P. demavendi lorestanus. Polyommatus pseudorjabovi was represented by a single differentiated haplogroup. A distinct haplogroup represented by a single haplotype was found within P. khorasanensis.
Concerning P. dolus group (Fig.
Haplotypes of our target taxa (P. aroaniensis, P. timfristos sp. n., P. orphicus and P. humedasae) formed together a single cluster. However, all these taxa were distinct, and they did not share any common haplotypes. Therefore, this cluster could be subdivided into four haplogroups: ar (P. aroaniensis), tim (P. timfristos), orph (P. orphicus) and hum (P. humedasae) (Table
Despite presumed conspecifity (
One of the main characteristic features of the anomalous blue butterflies is the upperside wing color. All males and females have brown upper side of the wings, and therefore the group is also called “brown” complex. As for the underside (Fig.
Polyommatus ripartii type: hindwing underside with well-developed white streak (character 2 in Fig.
Polyommatus valiabadi type: the wing underside with exaggerated spots, white streak on the hindwing underside is clearly visible and sharp. This type is found in P. valiabadi, P. rjabovianus and P. pseudorjabovi from Iran and Azerbaijan (Lukhtanov et al. 2015). This type is not found in European Agrodiaetus species.
Polyommatus admetus type: the hindwing has no white streak, marginal marking is very well pronounced. This type is found in P. admetus (Fig.
Polyommatus nephohiptamenos type: White streak is well pronounced and very broad on the hindwing, consisting of the main streak and an additional short streak between postdiscal and submarginal areas, just under the main streak. This type is common in P. nephohiptamenos (Fig.
Polyommatus humedasae type: no white streak on the hindwing, marginal marking is pale. This type is quite common in P. aroaniensis, P. timfristos (Fig.
Polyommatus aroaniensis type: the white streak on the hindwing underside demonstrates different level of reduction. This type is found in P. aroaniensis (Fig.
Polyommatus orphicus type: forewing underside with clear white postdiscal streak between discal spot and submarginal marking, white streak on hindwing underside is prominent, often with additional small white streak (Fig.
Polyommatus orphicus orphicus collected in the type locality (Bulgaria, Hvoyna, 3 July 2016). Photo by E. Pazhenkova. White postdiscal streak between discal spot and submarginal marking on the forewing underside (character 1), prominent white streak on the hindwing underside (character 2) and additional white short streak between postdiscal and submarginal areas of the hind wing underside (character 3) are shown.
The coloration and wing pattern of P. admetus, P. orphicus eleniae and P. orphicus orphicus. The letters correspond to the following sample numbers: a LR-08-D109 upperside and underside b LR-08-386 c LR-08-655 d LR-08-211 e LR-08-433 upperside and underside f LR-08-434 g LR-08-437 h LR-08-545 i LR-08-546 j LR-08-560. Scale bar corresponds to 10 mm in all figures.
The coloration and wing pattern of P. orphicus orphicus, P. orphicus eleniae and P. nephohiptamenos. The letters correspond to the following sample numbers: a LR-08-D561 b LR-08-431 c LR-08-483 upperside and underside d LR-08-496 e LR-08-498 f LR-08-499 upperside and underside g LR-08-485 upperside and underside h LR-08-494 upperside and underside, white postdiscal streak between discal spot and submarginal marking on the forewing underside is shown by arrow. Bar = 10 mm.
The coloration and wing pattern of P. ripartii pelopi. The letters correspond to the following sample numbers: a LR-08-D257 upperside and underside b LR-08-471 c LR-08-085 d LR-08-092 e LR-08-120 f LR-08-144 g LR-08-145 h LR-08-249 i LR-08-252 j LR-08-260 k LR-08-291. Bar = 10 mm.
The coloration and wing pattern of P. ripartii pelopi, P. timfristos sp. n. and P. aroaniensis. The letters correspond to the following sample numbers: a LR-08-D549 b LR-08-551 c LR-08-571 d LR-08-273 e LR-08-205 f LR-08-274 upperside and underside g LR-08-258 h LR-08-247 (Holotype) i LR-08-255 j LR-08-102 upperside and underside. White postdiscal streak between discal spot and submarginal marking on the forewing underside is shown by arrow. Bar = 10 mm.
The studied taxa were found to demonstrate a relatively low level of COI and ITS2 differentiation in terms of genetic distances between species and numbers of evolutionary steps between the taxa on haplotype network (Figs
The low genetic differentiantion results in relatively low support for some recovered clades (e.g. for P. timfristos, Figs
An entirely different situation was found in P. ripartii and P. admetus sensu auctorum. In these taxa polyphyly in COI trees arises as a result of deep intraspecific divergence. There are two theoretically possible explanations for this kind of non-monophyly. First, each taxon can be a mix of unrecognized multiple species (
The chromosome number of P. admetus was first established by H. de Lesse who discovered n=80 in populations from Bulgaria (Kalotina) and W Turkey, and n=78-80 (with predominance of n=79) in populations from the eastern part of Turkey (
This transpalearctic species has been known to have a stable karyotype (n=90, including one large, one medium and 88 small elements) throughout its whole distribution range from Spain in the west to the Altai in the east (
The haploid chromosome number was erroneously given for this taxon as n=8-11 by
The haploid chromosome number for this taxon was erroneously given as n=15-16 by
The chromosome number of P. orphicus was first established by
The chromosome number of P. eleniae was established first by
Here we reinvestigated the karyotypes of P. orphicus and P. eleniae originating directly from their type-localities. Our data confirm previous chromosome number counts, but do not confirm the differences in karyotype structures. In our opinion, the presumed differences could appear because of differences in staining techniques used by
The haploid chromosome number of this taxon is established first here as n=38 and thus differs by at least three fixed chromosome fussions/fixions from P. orphicus orphicus and P. orphicus eleniae (n=41-42). This number is similar (but not identical) to that found in P. humedasae (n=39,
The Balkan and west Turkish populations of Polyommatus admetus have a unique hindwing underside pattern (Polyommatus admetus type, Fig.
The distribution of COI haplotypes in P. ripartii demonstrates a very complex picture. This taxon is represented by several clades on the phylogenetic reconstructions. The West-European clade includes butterflies from France, Italy and Spain. Another clade (a “mixed”, or Eurasian clade) includes butterflies from the whole Western Palaearctic region from Spain to Mongolia. Eastern Turkish-Caucasian clade (P. ripartii paralcestis) is strongly differentiated and appears as a group close to P. demavendi. Complicated taxonomy and phylogeography of P. ripartii have recently been topics of several specific studies and publications (
Taxonomic interpretation of this local Balkan endemic is difficult since it is morphologically very similar and chromosomally seems to be identical to the close species P. ripartii. However, distinct COI barcodes in combination with ecological differentiation (P. nephohiptamenos is a high altitude species, whereas P. ripartii pelopi can be found usually at middle and low elevations) do not allow us to reject the pre-existing taxonomic hypotheis that P. nephohiptamenos represents a distinct taxonomic entity. The fact that P. nephohiptamenos retains its homogeneity with respect to COI being surrounded by closely related P. ripartii is additional indirect evidence for a presence of genetic boundaries between them. Further molecular and genetic studies are required to understand the real taxonomic status of P. nephohiptamenos.
Polyommatus dantchenkoi orphicus was described (
Our molecular data demonstrate that, despite similarity in number of chromosomes, P. d. dantchenkoi and P. d. orphicus are not closely related as was previously thought. In the haplotype network, these taxa were found to be placed in the opposite parts of the recovered net, being separated by a number of other species (Fig.
Polyommatus eleniae was described from a place located 80 km south-west from the type locality of P. orphicus. Polyommatus orphicus and P. eleniae have the same number of chromosomes, but it was supposed that they were different in karyotype structure (
This taxon was first described by
(Fig.
COI barcode sequence of the holotype, 657 base pairs.
ACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTCTAAGAATTTTAATTCGTATGGAATTAAGAACTCCTGGATCCTTAATTGGAAATGATCAAATTTATAATACTATTGTTACAGCCCATGCATTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTTCCCTTAATATTAGGAGCACCTGATATAGCTTTTCCACGATTAAATAATATGAGATTTTGATTATTACCGCCATCATTAATACTACTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCACATGGAGGATCATCTGTAGATTTAGCAATTTTCTCTCTTCATTTAGCGGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATCATTAATATACGAGTAAATAATTTATCTTTTGATCAAATATCATTATTTATTTGAGCAGTGGGAATTACAGCATTATTATTACTTTTATCATTGCCTGTATTAGCTGGGGCAATTACCATATTATTAACAGATCGAAATCTTAATACCTCATTCTTTGACCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
Haploid chromosome number of the holotype n=38 (Fig.
Four males, field codes LR-08-255, LR-08-258, LR-08-273, LR-08-274, forewing length 17–18 mm, the same data as holotype. Male: field code LR-08-205, Greece, Parnassos, 38°33.311'N; 22°34.300 E, 1750 m, 19 July 2008, V.A. Lukhtanov and N.A.Shapoval leg. Five females: forewing length 15–16 mm; Greece, Timfristos Mt, Karpenisi, 38°55.554'N; 21°48.460 E, 1490 m, 21 July 2008, V.A. Lukhtanov and N.A. Shapoval leg. Two females: forewing length 14.5–15.5 mm; Greece, Parnassos, 38°33.311'N; 22°34.300 E, 1750 m, 19 July 2008, V.A. Lukhtanov and N.A. Shapoval leg.. All paratypes are deposited in Zoological Institute of the Russian Academy of Science (St. Petersburg).
(Fig.
Underside: ground color light brown with yellowish coffee-milk tint. Greenish blue basal suffusion very slight, nearly lacking. One basal black spot is present only on hindwings. Discoidal black spot is present on the forewings, but can be slightly seen on the hindwings (absent or vestigial). Postdiscal black ocelli are encircled by a whitish border. They are prominent on the forewings, forming a strongly curved row. Postdiscal black ocelli on the hindwing small. Submarginal and antemarginal marking is absent on the forewings, and absent or vestigial on the hindwings. White streak on hindwings clearly visible. In one specimen the white streak is vestigial, in one the white streak is almost absent (can be slightly distinguished), and in one specimen there is an additional short streak between postdiscal and submarginal areas of the wing, straight under the main white streak. Fringe brown, slightly darker than the underside ground color.
Genitalia: the male genitalia have a structure typical for other species of the subgenus Agrodiaetus (Coutsis, 1986).
(Fig.
Polyommatus timfristos (n=38) differs by at least three fixed chromosome fusions/fissions from the most closely related and allopatric P. orphicus orphicus and P. orphicus eleniae (n=41-42). P. timfristos (n=38) differs by at least nine fixed chromosome fusions/fissions from allopatric P. aroaniensis (n=47). From the closely related P. orphicus and P. aroaniensis, P. timfristos differs also by a number of nucleotide substitutions within the studied 657-bp fragment of the mitochondrial COI gene.
The chromosome number in P. timfristos (n=38) is similar (but not identical) to that found in P. humedasae (n=39,
From sympatric and syntopic P. ripartii pelopi the new species can usually be distinguished by the absence of submarginal marking and strong reduction of greenish blue basal suffusion. These characteristics are usually (but not always) better expressed in P. r. pelopi specimens. In doubtful cases, the separation is only possible on the base of chromosomal and molecular markers since these species are different: the chromosome number of P. r. pelopi is n=90; they also have fixed differences in 33 positions within the studied 657-bp fragment of COI gene.
Polyommatus timfristos sp. n. inhabits xerothermic and xeromontane localities and dry meadows from 1200 to 1800 m altitude (Figs
Timfristos is a mountain in the eastern part of Evrytania and the western part of Phthiotis in Central Greece. The name is a noun.
Figs
This species is widespread in the Balkan Peninsula. It is local in the northern part of Hungary (
Fig.
Polyommatus ripartii is widespread in the southern part of the Balkan Peninsula (Greece and Bulgaria); however, it is more local in the north. It is known from Albania, the Republic of Macedonia, south Serbia (
Figs
Polyommatus nephohiptamenos has a dot-like distribution area and is known from the high altitudes of north-east Greece (Mt Pangeon, Mt Phalakro and Mt Orvilos) and south-west Bulgaria (Mt Orvilos, also known as Mt Slavyanka, Mt Alibotush and Kitka Planina) (
Fig.
Polyommatus aroaniensis has been considered as a relatively widespread species (
Our chromosomal data confirm P. aroaniensis in South Greece (Peloponnese), but cannot confirm it in Central and Northern Greece and in Bulgaria where it is replaced by the closely related allopatric species P. timfritos and P. orphicus. In the light of the data obtained, the occurrence of P. aroaniensis in Bulgaria, Albania, Macedonia and Bosnia and Herzegovina seems to be doubtful and requires a confirmation based on chromosomal analysis. We cannot exclude that the populations from Albania, Macedonia and Bosnia and Herzegovina could represent P. orphicus or even undescribed taxa of the subgenus Agrodiaetus.
Figs
This species is known from Timfristos and Parnassos Mts in Central Greece only.
Figs
This species is known from South Bulgaria and Northern Greece only. However, its occurrence in other countries in the northern Balkan is theoretically possible (see above).
Theoretically, the main groupings in the P. humedasae – P. orphicus – P. timfristos – P. aroaniesnsis subcomplex can be interpreted as subspecies-level taxa, if the polytypic species concept is applied. None of them appears to be sympatric in distribution, and taken together they form a moderately supported monophyletic lineage on the COI+ITS2 tree (Fig.
However, even if the last statement is true, it does not mean that chromosomal rearrangements are irrelevant to formation of genetic barriers between populations. Chromosome changes have been shown to be important in speciation in the blue butterflies (
Regardless of its taxonomic status as a species or subspecies, P. timfristos represents a unique entity within the genus Polyommatus that deserves additional study. A better understanding of its evolutionary history may be helpful in understanding mechanisms of chromosomal diversification within the genus, and may further elucidate the biogegraphy of the south Balkan and Aegean regions. As a distinct taxonomic entity occupying a very restricted area in Central Greece it should be considered a candidate on the list of protected species in Greece and the whole of Europe.
Analysis of distribution areas and phylogeny of the P. dolus lineage shows that the phylogeograpic history of this complex involved a combination of dispersal and vicariance events with a clear general trend of dispersal from the East (Iran), where the group most likely arose, to the West: to the Mediterranean area and to the Iberian Peninsula (
Three chromosomal sublineages discovered in our study (P. aroaniensis sensu stricto + P. orphicus +P. timfristos) represent late Pleistocene splits of the Balkan subclade that evolved in allopatry within the Balkan refugium. Given the deep level of chromosomal divergence between these sublineages, we assume that there was a long period of allopatric differentiation when they were separated by geographic or/and ecological barriers. In our opinion, this is evidence for presence of three separate Balkan subrefugia in the past (Pelonnese, Central Greece and Northern Grecee/South Bulgaria).
Greece, as a part of the Balkan Peninsula, has been already reported to harbor genetically differentiated lineages from the rest of the Balkans for a number of animal species as a result of evolution in multiple separate refugia (
We propose the following taxonomic arrangement of the P. dolus and P. admetus lineages (chromosome numbers are in parentheses when known, the Balkan taxa are in bold):
P. dolus lineage
P. dolus (Hübner, [1823])
P. dolus dolus (Hübner, [1823]) (n=123-125)
P. dolus vittatus (Oberthür, 1892) (n=124-125)
P. dolus virgilia (Oberthür, 1910) (n=122)
P. dolus gargano (Wimmers, 1931) (n=122)
P. dolus paravirgilia Verity, 1943 (n unknown)
P. fulgens (Sagarra, 1925)
P. fulgens fulgens (Sagarra, 1925) (n=109)
P. fulgens ainsae (Forster, 1961) (n=108-110)
P. fulgens pseudovirgilia (de Lesse, 1962) (n=108)
P. fulgens leonensis (Verhulst, 2004) (n unknown)
P. menalcas (Freyer, [1837]) (n=85)
P. fabressei (Oberthür, 1910) (n=90)
P. violetae (Gómez-Bustillo, Expósito & Martínez, 1979)
P. violetae violetae (Gómez-Bustillo, Expósito & Martínez, 1979) (n=90)
P. violetae subbaeticus (Gil-T. & Gil-Uceda, 2005) (n=90)
P. humedasae (Toso & Balletto, 1976) (n=39)
P. orphicus Kolev, 2005
P. orphicus orphicus Kolev, 2005 (n=41-42)
P. orphicus eleniae Coutsis & De Prins, 2005 (n=41-42)
P. timfristos Lukhtanov, Vishnevskaya & Shapoval, sp. n. (n=38)
P. aroaniensis (Brown, 1976) (n=47)
P. alcestis (Zerny, 1932) (n=20-21)
P. karacetinae (Lukhtanov & Dantchenko, 2002)
P. karacetinae karacetinae (Lukhtanov & Dantchenko, 2002) (n=19)
P. karacetinae urmiaensis Schurian & Ten Hagen, 2003, comb. n. (n=19)
P. dantchenkoi (Lukhtanov & Wiemers, 2003) (n=40-42)
P. eriwanensis (Forster, 1960) (n=32-34)
P. interjectus (de Lesse, 1960) (n=29-32)
P. rjabovianus (Koҫak, 1980) (= rjabovi (Forster, 1960)
P. rjabovianus rjabovianus (Koҫak, 1980) (n=49)
P. rjabovianus masul Lukhtanov, Dantchenko, Vishnevskaya & Saifitdinova, 2015 (n=43)
P. valiabadi (Rose & Schurian, 1977) (n=24)
P. admetus lineage
P. ripartii (Freyer, 1830)
P. ripartii ripartii (Freyer, 1830) (= agenjoi Forster, 1965; = budashkini Kolev & de Prins, 1995; = exuberans Verity, 1926; = montanesa Gómez-Bustillo, 1971; = mozuelica Agenjo, 1973; = ovchinnikovi Lukhtanov & Dantchenko, 2002; = ramonagenjo Koçak & Kemal, 2001; = rippertii Boisduval, 1832; = sarkani Lukhtanov & Dantchenko, 2002; = susae Bertaccini, 2003) (n=90)
P. ripartii pelopi (Brown, 1976) (n=90)
P. ripartii paralcestis (Forster, 1960) (n=90)
P. ripartii colemani (Lukhtanov & Dantchenko, 2002) (n=90)
P. ripartii tengritaghicus Koҫak & Kemal, 2001 (n unknown)
P. nephohiptamenos (Brown & Coutsis, 1978) (n=90)
P. demavendi (Pfeiffer, 1938) (n=67-74)
P. demavendi demavendi (Pfeiffer, 1938)
P. demavendi amasyensis (de Lesse, 1961)
P. demavendi belovi (Dantchenko & Lukhtanov, 2005)
P. demavendi ahmadi (Carbonell, 2001)
P. demavendi lorestanus Eckweiler, 1997
P. khorasanensis (Carbonell, 2001) (n=74)
P. pseudorjabovi Lukhtanov, Dantchenko, Vishnevskaya & Saifitdinova, 2015 (n=79)
P. admetus (Esper, [1783]) (= anatoliensis Forster, 1960) (n=80)
P. yeranyani (Dantchenko & Lukhtanov, 2005), stat. n.
P. yeranyani yeranyani (Dantchenko & Lukhtanov, 2005) (n=78-80)
P. yeranyani malievi (Dantchenko & Lukhtanov, 2005), comb. n. (n=78-80)
The complete financial support for this study was provided by the grant from the Russian Science Foundation N 14-14-00541 to The Zoological Institute of the Russian Academy of Sciences. The work was held in the laboratory of “Chromas” Core facility and Centre for Molecular and Cell Technologies of St. Petersburg State University, and in “The Laboratory of animal genetics” of Biological Institute. We thank Nazar Shapoval, Elena Pazhenkova and Lukas Rieppel for their help in material collecting in the Balkan Peninsula, and Svetlana Nedoshivina and Andrei Barabanov for their help in material collecting in Tigireksky Reservation, Russia. We thank Lukasz Przybyłowicz and Nazar Shapoval for critical comments. We also would like to mention, that the expedition to the Balkan Peninsula in 2008 would have been impossible without the help of Naomi Pierce.
Alphabetical list of the nominal taxa described within the Polyommatus (Agrodiaetus) admetus and Polyommatus (Agrodiaetus) dolus complexes.
admetus (Esper, [1783])
Original combination: P.[apilio] Pl.[ebeius] Rur.[alis] Argus Admetus
In: Esper EJC (1777-1807) Die Schmetterlinge in Abbildungen nach der Natur mit Beschreibungen (I)2: 148; Tab. LXXXII, figs 2, 3.
Type locality: “Ungarn ... bis nach Semlin an die Gränze von Sclavonien” [Hungary].
Syntypes in Naturwissenschaftliche Sammlung, Wiesbaden, Germany, and in Zoologische Staatssammlung, Munich, Germany (after
Current status: species.
ahmadi (Carbonell, 2001)
Original combination: Agrodiaetus ahmadi
In: Carbonell F (2001) Contribution à la connaissance du genre Agrodiaetus Hübner (1822), A. ahmadi et A. khorasanensis nouvelles espèces dans le Nord de l‘Iran (Lepidoptera, Lycaenidae). Linneana Belgica 18: 105–110.
Type locality: environs d’Alulak, 1600 m., E. Prov. De Zanjan, N. Iran [N Iran, Alilak, Qazvin].
Holotype in Muséum National d’Histoire Naturelle, Paris.
Current status: subspecies of P. (A.) demavendi (after
agenjoi (Forster, 1965)
Original combination: Agrodiaetus admetus agenjoi
In: Forster W (1965) Agrodiaetus admetus agenjoi ssp. n. Entomologische Zeitschrift 75(18): 198.
Type locality: “Barcelona, Taradell” [Spain: Barcelona].
Holotype in Museo Nacional de Ciencias Naturales, Madrid, Spain (after
Current status: preoccupied name (see ramonagenjoi).
ainsae (Forster, 1961)
Original combination: Agrodiaetus dolus ainsae
In: Forster W (1961) Bausteine zur Kenntnis der Gattung Agrodiaetus Scudd. (Lep. Lycaen.) II. Zeitschrift der Wiener Entomologischen Gesellschaft 46: 76. Taf. 14, 15, figs 5, 6.
Type locality: “Spanien, Pyrenäen, Ainsa” [Spain: Huesca].
Holotype in Naturhistorisches Museum, Wien, Austria.
Current status: subspecies of P. (A.) fulgens (after
alcestis (Zerny, 1932)
Original combination: Lycaena (Hirsutina) ripperti alcestis
In: Zerny H (1932) Lepidopteren aus dem nördlichen Libanon. Deutsche Entomologische Zeitschrift Iris 46(4): 186.
Type locality: Becharré [Lebanon].
Lectotype in The Natural History Museum, London (after
Current status: species.
amasina (Neuburger, 1900)
Original combination: Lycaena menalcas ab. amasina
In: Neuburger W (1900) Lycaena menalcas Frr. ♂ aberr. (Lep.). Illustrierte Zeitschrift für Entomologie 5: 370.
Type locality: “Aus der Gegend von Amasia” [Turkey: Amasya].
Holotype in coll. W. Neuburger [?] (after
Current status: unavailable (infrasubspecific name).
amasyensis (de Lesse, 1961)
Original combination: Agrodiaetus demavendi amasyensis
In: de Lesse H (1961) Variations géographiques des caractères externes chez les espèces autrefois réunies sous le nom d’Agrodiaetus ripartii Freyer (Lep. Lycaenidae). Revue Française d’Entomologie 28(2): 96.
Type locality: “Amasya” [Turkey: Amasya].
Holotype in Museum National d’Histoire Naturelle, Paris, France (after
Current status: subspecies of P. (A.) demavendi (after
anatoliensis (Forster, 1960)
Original combination: Agrodiaetus admetus anatoliensis
In: Forster W (1960) Einige neue Formen der Gattung Agrodiaetus Scudd. (Lep. Lycaen.). Entomologische Zeitschrift 70(3): 20.
Type locality: “Akshehir” [Turkey: Akşehir].
Holotype in Zoologische Staatssammlung, München, Germany (after
Current status: synonym of P. (A.) admetus admetus (after
anticodiscoelongata (Verity, 1943)
Original combination: Agrodiaetus dolus anticodiscoelongata
In: Verity R (1943) Farfalle diurne d’Italia 2: 323.
Type locality: “Monti Sibillini” [Central Italy].
Current status: synonym of P. (A.) dolus virgilius (after
aroaniensis (Brown, 1976)
Original combination: Agrodiaetus alcestis aroaniensis
In: Brown J (1976) Notes regarding previously undescribed European taxa of the genera Agrodiaetus Hübner, 1822 and Polyommatus Klug, 1801 (Lep., Lycaenidae). Entomologist’s Gazette 27(2): 78.
Type locality: “Kamena Allonia, Mt. Chelmos” [Greece: Peloponnese].
Holotype in coll. J. Brown, Sutton (after
Current status: species.
belovi (Dantchenko & Lukhtanov, 2005)
Original combination: Agrodiaetus belovi
In: Dantchenko A, Lukhtanov V (2005) New taxa of the brown species-complex of the genus Agrodiaetus Hübner, (1822) from Transcaucasia (Lepidoptera, Lycaenidae). Atalanta 35: 327–334, 472–475.
Type locality: Armenia, Gegamsky mts.
Holotype in Museum of Comparative Zoology (Harvard University, Cambridge, MA, USA).
Current status: subspecies of P. (A.) demavendi (after
budashkini (Kolev & De Prins, 1995)
Original combination: Polyommatus (Agrodiaetus) budashkini
In: Kolev Z, De Prins W (1995) A new species of the “brown Agrodiaetus” complex from the Crimea (Lepidoptera: Lycaenidae). Phegea 23(2): 121.
Type locality: “Crimea, Sudak” [Ukraine: Crimea].
Holotype in Vlaamse Lepidoptera Collectie, Antwerpen.
Current status: synonym of P. (A.) ripartii ripartii.
colemani (Lukhtanov & Dantchenko, 2002)
Original combination: Agrodiaetus ripartii colemani
In: Lukhtanov V, Dantchenko A (2002) Descriptions of new taxa of the genus Agrodiaetus Hübner, [1822] based on the karyotype investigation (Lepidoptera, Lycaenidae). Atalanta 33(1/2): 81–107.
Type locality: Kazakhstan, Shymkentskaya oblast’, Ugamskiy Khrebet, Saryaigyr, 1600 m.
Holotype in Museum of Comparative Zoology, Harvard University, Cambridge, MA, USA.
Current status: subspecies of P. (A.) ripartii.
crassipuncta (Stauder, 1921)
Original combination: Lycaena dolus virgilia f. n. crassipuncta
In: Stauder (1921) Deutsche Entomologische Zeitschrift [Iris] 35: 31.
Type locality: “Unteritalien” [South Italy].
Current status: synonym of P. (A.) dolus virgilius (after
dantchenkoi (Lukhtanov & Wiemers, 2003)
Original combination: Agrodiaetus dantchenkoi
In: Lukhtanov V, Wiemers M, Meusman K (2003) Description of a new species of the “brown” Agrodiaetus complex from South-East Turkey (Lycaenidae). Nota lepidopterologica 26(1/2): 65–71.
Type locality: Turkey, Prov. Van, 34 km N Catak [SE Turkey (Van)].
Holotype in Museum of Comparative Zoology, Harvard University, Cambridge, MA, USA.
Current status: species.
demavendi (Pfeiffer, 1938)
Original combination: Lycaena ripertii ssp. n. demavendi m.
In: Pfeiffer E (1938) Notizen über persische Lycaenidae (Lepid.). Mitteilungen der Münchner Entomologischen Gesellschaft 28(2): 194.
Type locality: Ort Demavend (Tar-Tal) 2200-2500 m [Iran: Elburs mts.].
Holotype in Zoologische Staatssammlung, München, Germany (after
Current status: species.
discoelongata (Courvoisier, 1914)
Original combination: Lycaens dolus disco-elongata
In: Courvoisier (1914) Deutsche Entomologische Zeitschrift [Iris] 28: 186.
Type locality: not stated.
Current status: synonym of P. (A.) dolus (after
dolus (Hübner, [1823])
Original combination: Papilio Dolus
In: Hübner J (1796-[1838]) Sammlung europäischer Schmetterlinge I. Taf. 159, figs 793–796.
Type locality: [S France].
Current status: species.
elachista (Dannehl, 1927)
Original combination: Lycaena dolus elachista
In: Dannehl F (1927) Neue Formen und geografische Rassen aus meinem Rhopaloceren-Ausbeuten der letzten Jaren. Mitteilungen der Münchner Entomologischen Gesellschaft 17: 7-8.
Type locality: “Mt. Sabini (Gennaro), Simbruini, Velino, Sirente,… bei Aquila, Gran-Sasso, Morrone, Agatone, Majella” [Central and South Italy].
Current status: synonym of P. (A.) dolus virgilius (after
eleniae Coutsis & De Prins, 2005
Original combination: Polyommatus (Agrodiaetus) eleniae
In: Coutsis J, De Prins J (2005) A new brown Polyommatus (Agrodiaetus) from northern Greece (Lepidoptera: Lycaenidae). Phegea 33(4): 129–137.
Type locality: Greece, Makedonía, Dráma district, Mt. Falakró, eastern foothills, near Granítis, 900 m.
Holotype in Zöologisch Museum, Universiteit van Amsterdam, Netherlands.
Current status: subspecies of P. (A.) orphicus.
epidolus (Boisduval, 1840)
Original combination: Lycaena Epidolus
In: Boisduval [JBA] (1840): Genera et Index Methodictis Europaeorum Lepidopterorurn, p. 13.
Type locality: “Turcia” [Turkey].
Lectotype in The Natural History Museum, London (after
Current status: synonym of P. (A.) menalcas (after:
eriwanensis (Forster, 1960)
Original combination: Agrodiaetus ripartii eriwanensis
In: Forster W (1960) Einige neue Formen der Gattung Agrodiaetus Scudd. (Lep. Lycaen.). Entomologische Zeitschrift 70(3): 19.
Type locality: “Eriwan” [Armenia, Yerevan].
Holotype in Zoologische Staatssammlung, München, Germany (after
Current status: species.
exuberans (Verity, 1926)
Original combination: Hirsutina admetus race exuberans
In: Verity R (1926) Zygaenae, Grypocera and Rhopalocera of the Cottian Alps compared with other races. The Entomologist’s Record and Journal of Variation 38(9): 121.
Type locality: “Oulx” [Italy: Piemonte: Torino].
Syntypes in Museo Zoologico de la Specola, Firenze, Italy (after
Current status: synonym of P. (A.) ripartii ripartii (after
fabressei (Oberthür, 1910)
Original combination: Lycaena rippertii fabressei
In: Oberthür C (1910) Notes pour servir à établir la Faune Franςaise et Algérienne des Lepidopteres (suite). Etudes de Lépidoptérologié Comparee 4(1): 260.
Type locality: “à Albarracin” [Spain: Teruel].
Lectotype in The Natural History Museum, London (after
Current status: species.
fulgens (De Sagarra, 1925)
Original combination: Hirsutina dolus rassa fulgens
In: De Sagarra I (1925) Anotacions a la lepidopterologia ibèrica III (1). Formes noves dignes d’esment. Butlleti de la Institución Catalana de Historia Natural 5(9): 271.
Type locality: “Santa Coloma de Queralt” [Spain: Cataluňa].
Holotype in Museu de Catalunya, Barcelona, Spain (after
Current status: species.
galloi (Balletto & Toso, 1979)
Original combination: Agrodiaetus galloi
In: Balletto E, Toso G (1979) On a new species of Agrodiaetus (Lycaenidae) from Southern Italy. Nota Lepidopterologica 2(1/2): 13–25.
Type locality: Pollino, Lucania, Southern Italy, loc. Piano di Ruggio, 1550 m.
Holotype in Museo Civico di Storia Naturale Giacomo Doria, Genova, Italy.
Current status: synonym of P. (A.) ripartii ripartii (after
gargano (Wimmers, 1931)
Original combination: Lyc.[aena] dolus var. gargano
In: Wimmers C (1931) Aus der Lepidopteren-Fauna Italiens (Apulien). Entomologische Zeitschrift 45(7): 96.
Type locality: “Mte. Gargano” [Italy: Puglia: Foggia].
Current status: subspecies of P. (A.) dolus (after
humedasae (Toso & Balletto, 1976)
Original combination: Agrodiaetus humedasae
In: Toso G, Balletto E (1976) Una nuova specie del genere Agrodiaetus Hübn. (LepidopteraLycaenidae). Annali del Museo Civico di Storia Naturale Giacomo Doria 81: 125.
Type locality: dintorni di Cogne, Val d'Aosta [Italy: Valle d'Aosta].
Holotype in Museo Civico di Storia Naturale “Giacomo Doria”, Genova, Italy (after
Current status: species.
infralunulata (Verity, 1943)
Original combination: Agrodiaetus dolus infralunulata
In: Verity R (1943) Farfalle diurne d’Italia 2: 323.
Type locality: not stated.
Syntypes possibly in The Natural History Museum, London (after
Current status: synonym of P. (A.) dolus virgilius (after
interjectus (de Lesse, 1960)
Original combination: Agrodiaetus interjectus
In: de Lesse H (1960) Les nombres de chromosomes dans la classification du groupe d'Agrodiaetus ripartii Freyer (LepidopteraLycaenidae). Revue Franςaise d'Entomologie 27(3): 253.
Type locality: “Erzincan ... 1200 m” [Turkey: Erzincan].
Holotype in Museum National d’Histoire Naturelle, Paris, France (after
Current status: species.
iris (Agenjo, [1973])
Original combination: Plebejus (Agrodiaetus) damon iris
In: Agenjo R (1971) Nuevas subespecies de ropalóceros ibéricos. Graellsia 26: 30.
Type locality: “Puerto de Pozazal, a 1 001 m., en Valdeprado del Río, provincia de Santander” [Spain: Santander].
Holotype in coll. G. Pardo, Torrelavega (after
Current status: synonym of P. (A.) fulgens pseudovirgilia (after
karacetinae (Lukhtanov & Dantchenko, 2002)
Original combination: Agrodiaetus alcestis karacetinae
In: Lukhtanov V, Dantchenko A (2002) Description of new taxa of the genus Agrodiaetus (Hübner, 1822) based on karyotype investigation. Atalanta 33(1/2): 81–107.
Type locality: Turkey, Hakkari, Dez Valley, 1500 m.
Holotype in Institute of Systematic and Population Biology (Zoological Museum), Amsterdam, Netherlands.
Current status: species.
khorasanensis (Carbonell, 2001)
Original combination: Agrodiaetus khorasanensis
In: Carbonell F (2001) Contribution à la connaissance du genre Agrodiaetus Hübner (1822), A. ahmadi et A. khorasanensis nouvelles espèces dans le Nord de l’Iran (Lepidoptera, Lycaenidae). Linneana Belgica 18: 105–110.
Type locality: North-East Iran, Khorasan.
Holotype in Muséum National d’Histoire Naturelle in Paris.
Current status: species.
lefebvrii (Godart, [1824])
Original combination: Polyommatus Lefebvrii
In: Latreille [PA], Godart [J B] (1819[-1824]) Encyclopédie Métho-dique. Histoire Naturelle. 9. Entomologie, ou Histoire Naturelle des Crustaces, des Arachnides et des Insectes, p. 696.
Type locality: “aux environs de Toulon ... et dans les Bouches-du-Rhône” [France: Var/Bouches-du-Rhône].
Syntypes in [Toulon] and [Bouches-du-Rhône] [?] (after
Current status: synonym of P. (A.) dolus dolus (after
leonensis (Verhulst, 2004)
Original combination: Agrodiaetus ainsae leonensis
In: Verhulst J (2004) Description d’une nouvelle sous-espèce d’Agrodiaetus ainsae Forster, 1961 provenant de la province de Leon (Lep. Lycaenidae). Linneana Belgica 19(5): 209–212.
Type locality: the vicity of Cistierna, Leon province, northern Spain.
Holotype in Institut des Sciences Naturalles de Bruxelles (after Verhulst 2004).
Current status: subspecies of P. (A.) fulgens (after
lorestanus Eckweiler, 1997
Original combination: Polyommatus (Agrodiaetus) demavendi lorestanus
In: Eckweiler W (1997) Neue Taxa von Polyommatus (Agrodiaetus) (Lepidoptera: Lycaenidae). Nachrichten des Entomologischen Vereins Apollo Supplementum 16: 8.
Type locality: “Iran, Lorestan, Dorud, Saravand, 2000-2300 m” [Iran: Zagros mts.].
Holotype in coll. W. Eckweiler in Naturkundemuseum, Karlsruhe, Germany.
Current status: subspecies of P. (A.) demavendi (after
magnabrillata (Gomez-Bustillo, 1971)
Original combination: Plebejus dolus magnabrillata
In: Gomez-Bustillo M (1971) For un mejor conosimiento de los ropaloceros españoles. Sociedad de Ciencias Naturales Aranzadi, Publicacion N° 19: 8
Type locality: “Puerto de Pozazal (1000 m), T. M. de Valdeprado, Prov. de Santander” [Spain: Santander].
Holotype in coll. M. Gomez-Bustillo, Madrid (after
Current status: synonym of P. (A.) dolus pseudovirgilia (after
malievi (Dantchenko & Lukhtanov, 2005)
Original combination: Agrodiaetis admetus malievi
In: Dantchenko A, Lukhtanov V (2005) New taxa of the brown species-complex of the genus Agrodiaetus Hübner, (1822) from Transcaucasia (Lepidoptera, Lycaenidae). Atalanta 35: 327–334, 472–475.
Type locality: Azerbaijan, Talysh mts.
Holotype in Museum of Comparative Zoology, Harvard University, Cambridge, MA, USA.
Current status: subspecies of P. (A.) yeranyani.
masul Lukhtanov, Dantchenko, Vishnevskaya & Saifitdinova, 2015
Original combination: Polyommatus (Agrodiaetus) rjabovianus masul
In: Lukhtanov V, Dantchenko A, Vishnevskaya M, Saifitdinova A (2015) Detecting cryptic species in sympatry and allopatry: analysis of hidden diversity in Polyommatus (Agrodiaetus) butterflies (Lepidoptera: Lycaenidae). Biological Journal of the Linnean Society 116: 468–485.
Type locality: North Iran, Gilan, vicinity of Masuleh, 2200 m.
Holotype in Zoological Institute of the Russian Academy of Science, St. Petersburg, Russia.
Current status: subspecies of P. (A.) rjabovianus.
menalcas (Freyer, [1837])
Original combination: Lycaena Menalcas
In: Freyer C ([1836]-1839) Neuere Beiträge zur Schmetterlingskunde. 3. Band, 38. Heft, p. 46; tab. 223, figs 2–3.
Type locality: “bei Konstantinopel” [Turkey: Istanbul].
Lectotype in The Natural History Museum, London (after
Current status: species.
montanesa (Gomez-Bustillo, 1971)
Original combination: Plebejus rippartii montañesa
In: Gomez-Bustillo M (1971) Por un mejor conosimiento de los ropaloceros espanoles. Sociedad de Ciencias Naturales Aranzadi, Publicacion N° 19: 8.
Type locality: “T. M. de Valdeprado, Prov. de Santander” [Spain: Santander].
Holotype in coll. M. Gomez-Bustillo,Madrid [?] (after
Current status: synonym of P. (A.) ripartii (after
mozuelica (Agenjo, [1973])
Original combination: Plebejus (Agrodiaetus) ripartii mozuelica
In: Agenjo R (1971 [1973]) Nuevas subespecies de ropalóceros ibéricos. Graellsia 26: 31.
Type locality: “Mozuelos, at 840 m., provincia de Burgos” [Spain: Burgos].
Holotype in National Institute of Entomology (Institute Español de Entomologia), Madrid, Spain (after
Current status: synonym of P. (A.) ripartii ripartii (after
nephohiptamenos (Brown & Coutsis, 1978)
Original combination: Agrodiaetus nephohiptamenos
In: Brown J, Coutsis JG (1978) Two newly discovered lycaenid butterflies (Lepidoptera: Lycaenidae) from Greece, with notes on allied species. Entomologist's Gazette 29(4): 207.
Type locality: “mountains of NE. Greece, 1800 m” [Greece].
Holotype in coll. J. Brown, Sutton (after
Current status: species.
obsoleta (Stauder, 1921)
Original combination: Lycaena dolus virgilia f.n. obsoleta
In: Stauder (1921) Deutsche Entomologische Zeitschrift [Iris] 35: 31
Type locality: “Unteritalien” [South Italy].
Syntypes [possibly in BMNH, London] (after
Current status: synonym of P. (A.) dolus virgilius (after
orphicus Kolev, 2005
Original combination Polyommatus dantchenkoi orphicus
In: Kolev Z (2005) Polyommatus dantchenkoi (Lukhtanov et Wiemers, 2003) tentatively identified as new to Europe, with a description of a new taxon from the Balkan Peninsula (Lycaenidae). Nota lepidopterologica 28(1): 25–34.
Type locality: South Bulgaria, Rhodopi mts, Hvoyna.
Holotype in National Museum of Natural History, Sofia, Bulgaria.
Current status: species.
ovchinnikovi (Lukhtanov & Dantchenko, 2002)
Original combination: Agrodiaetus ripartii ovchinnikovi
In: Lukhtanov V, Dantchenko A (2002) Descriptions of new taxa of the genus Agrodiaetus Hübner , [1822] based on the karyotype investigation (Lepidoptera, Lycaenidae). Atalanta 33(1/2): 81–107.
Type locality: Kazakhstan, Vostochno-Kazakhstanskaya oblast’, Zyryanovskij raion, Kremnyukha, 450 m.
Holotype in Zoological Institute of the Russian Academy of Science, St. Petersburg, Russia.
Current status: synonym of P. (A.) ripartii ripartii.
paralcestis (Forster, 1960)
Original combination: Agrodiaetus ripartii paralcestis
In: Forster W (1960) Einige neue Formen der Gattung Agrodiaetus Scudd. (Lep. Lycaen.). Entomologische Zeitschrift 70(3): 17.
Type locality: “Akschehir, Sultan Dagh 1700-2200 m” [Turkey: Konya].
Holotype in Zoologische Staatssammlung, München, Germany (after
Current status: subspecies of P. (A.) ripartii.
paravirgilius (Verity, 1943)
Original combination: Agrodiaetus dolus sattorazza paravirgilia
In: Verity R (1943) Farfalle diurne d’Italia 2: 325.
Type locality: “Monte Faito della penisola Sorrentina” [S. Italy, Sorrento peninsula].
Current status: subspecies of P. (A.) dolus (after
paucipuncta Lhomme, 1927
Original combination: Polyommatus dolus paucipuncta
In: Lhomme (1927) Amateur De Papillons 3: 192.
Type locality: not stated.
Current status: synonym of P. (A.) dolus (after
pelopi (Brown, 1976)
Original combination: Agrodiaetus ripartii pelopi
In: Brown J (1976) On two previously undescribed subspecies of Lycaenidae (Lepidoptera) from Greece. Entomologische Berichten 36(3): 47.
Type locality: Troupa, Mt. Chelmos, Greece, 1300 m [Greece: Peloponnese].
Holotype in coll. J. Brown, Sutton (after
Current status: subspecies of P. (A.) ripartii.
pseudorjabovi Lukhtanov, Dantchenko, Vishnevskaya & Saifitdinova, 2015
Original combination: Polyommatus (Agrodiaetus) pseudorjabovi
In: Lukhtanov V, Dantchenko A, Vishnevskaya M, Saifitdinova A (2015) Detecting cryptic species in sympatry and allopatry: analysis of hidden diversity in Polyommatus (Agrodiaetus) butterflies (Lepidoptera: Lycaenidae). Biological Journal of the Linnean Society 116: 468–485.
Type locality: Azerbaijan, Talysh mt., Zuvand plateau, vicinity of Mistan village.
Holotype in Zoological Institute of the Russian Academy of Science, St. Petersburg.
Current status: species.
pseudovirgilia (de Lesse, 1962)
Original combination: Agrodiaetus dolus pseudovirgilia
In: de Lesse H (1962) Variation chromosomique chez Agrodiaetus dolus HB. (Lep. Lycaenidae). Alexanor 2(7): 285.
Type locality: “25 km W. Burgos, près Villanueva de Aragon” [Spain: Burgos].
Holotype in Museum National d’Histoire Naturelle, Paris, France (after
Current status: subspecies of P. (A.) fulgens.
punctigera (Dannehl, 1927)
Original combination: Lycaena dolus punctigera
In: Dannehl F (1927) Neue Formen und geografische Rassen aus meinem Rhopaloceren-Ausbeuten der letzten Jaren. Mitteilungen der Münchner Entomologischen Gesellschaft 17: 7–8.
Type locality: “Mt. Sabini (Gennaro), Simbruini, Velino, Sirente,… bei Aquila, Gran-Sasso, Morrone, Agatone, Majella” [Central and South Italy].
Current status: synonym of P. (A.) dolus virgilius (after
ramonagenjo Koçak & Kemal, 2001
Original combination: Polyommatus (s. str. (Agrodiaetus (Admetusia)) ripartii ssp. ramonagenjo
In: Koçak A, Kemal M (2001) Polyommatus Latr. Cinsideki Agrodiaetus Seksiyonunun Biyolojik Çestiligi Zoocografyasi ve Taksonomisi Üzerine bir Arastirma (Lycaenidae, Lepidoptera). CESA Miscellaneous Papers 78/79: 1–11.
Current status: a replacement name for Agrodiaetus admetus agenjoi nec Polyommatus escheri race/form agenjoi Higgins, 1948. Synonym of Polyommatus ripartii ripartii(
ripartii (Freyer, 1830)
Original combination: Lycaena Ripartii
In: Freyer C (1830) Beiträge zur Geschichte europäischer Schmetterlinge mit Abbildungen nach der Natur, 3. Band, 23. Heft: 128; tab. 133, fig. 3.
Type locality: “Spanien” [Spain].
Lectotype in The Natural History Museum, London (after
Current status: species.
rippertii (Boisduval, 1832)
Original combination: Polyommatus Rippertii
In: Boisduval [JBA] (1832-1843) Icones historique des Lépidoptères nouveaux ou peu connus 1 : 68. Pl. 16, figs 4–6.
Type locality: “aux environs de Digne” [France: Alpes de Haute Provence].
Lectotype in The Natural History Museum, London (after
Current status: synonym of P. (A.) ripartii (
rjabovi (Forster, 1960)
Original combination: Agrodiaetus rjabovi
In: Forster W (1960) Agrodiaetus rjabovi sp. n. Entomologische Zeitschrift 70(14): 157.
Type locality: “Talysh, distr. Lenkoran, Ljulakeran” [Azerbaijan].
Holotype in Zoologische Staatssammlung, München, Germany (after
Current status: invalid name, junior secondary homomym of Polyommatus thersites rjabovi Obraztsov, 1936, replaced by P. (A.) rjabovianus.
rjabovianus (Koҫak, 1980)
Original combination: Agrodiaetus valiabadi nom. n. rjabovianus
In: Koҫak A (1980) On the nomenclature of some genus- and species-group names of Lepidoptera. Nota lepidopterologica 2(4): 142.
Type locality: see rjabovi Forster, 1960.
Type material: see rjabovi Forster, 1960.
Current status: Replacement name for Agrodiaetus rjabovi Forster, 1960.
rufomaculata (Dannehl, 1927)
Original combination: Lycaena dolus Hb. ♀ rufomaculata
In: Dannehl F (1927) Neue Formen und geografische Rassen aus meinem Rhopaloceren-Ausbeuten der letzten Jahren. Mitteilungen der Münchner Entomologischen Gesellschaft 17: 7–8.
Type locality: “Mt. Sabini (Gennaro), Simbruini, Velino, Sirente,… bei Aquila, Gran-Sasso, Morrone, Agatone, Majella” [Central and South Italy].
Current status: synonym of P. (A.) dolus virgilius (after
sarkani (Lukhtanov & Dantchenko, 2002)
Original combination: Agrodiaetus ripartii sarkani
In: Lukhtanov V, Dantchenko A (2002) Descriptions of new taxa of the genus Agrodiaetus Hübner, [1822] based on the karyotype investigation (Lepidoptera, Lycaenidae). Atalanta 33 (1/2): 81–107.
Type locality: Kazakhstan, Taldy-Kurganskaya oblast’, Dzhungarian Alatau, Andreevskij rayon (Kabanbai), Kolbai vic., 800 m.
Holotype in Museum of Comparative Zoology, Harvard University, Cambridge, MA, USA.
Current status: synonym of P. (A.) ripartii ripartii (after
splendens (Gomez-Bustillo, 1971)
Original combination: Plebejus damon subsp. splendens
In: Gomez-Bustillo M (1971) For un mejor conosimiento de los ropaloceros españoles. Sociedad de Ciencias Naturales Aranzadi, Publicacion N° 19: 6.
Type locality: “Puerto de Pozazal (1000 m), T. M. de Valdeprado, Prov. de Santander” [SPAIN: Santander].
Holotype in coll. M. Gomez-Bustillo, Madrid [?] (after
Current status: synonym of P. (A.) fulgens pseudovirgilia (after
splendida (Dannehl, 1927)
Original combination: Lycaena dolus splendida
In: Dannehl F (1927) Neue Formen und geografische Rassen aus meinem Rhopaloceren-Ausbeuten der letzten Jaren. Mitteilungen der Münchner Entomologischen Gesellschaft 17: 7–8. Type locality: “Mt. Sabini (Gennaro), Simbruini, Velino, Sirente,… bei Aquila, Gran-Sasso, Morrone, Agatone, Majella” [Central and South Italy].
Syntypes [possibly in BMNH, London] (after
Current status: synomym of P. (A.) dolus virgilius (after
subbaeticus (Felipe Gil-T. & Talia Gil-Uceda, 2005)
Original combination: Agrodiaetus fabressei subbaeticus
In: Felipe Gil-T, Talia Gil-Uceda (2005) Agrodiaetus violetae (Gómez-Bustillo, Expósito et Martínez, 1979): morfología comparada y descripción de Agrodiaetus fabressei subbaeticus ssp. n. del sureste de la península Ibérica (Lepidoptera, Lycaenidae). Boletín Sociedad Entomológica Aragonesa 36(4): 361.
Type locality: Spain, Iberica peninsula, N. Sierra de la Sagra.
Holotype in coll. of Dr. U. Eitschberger, McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, USA.
Current status: subspecies of P. (A.) violetae.
subtusradiata (Oberthür, 1910)
Original combination: Lycaena Ripertii Subtus radiata
In: Oberthür (1910) Études de Lépidopterologie Comparee 4: 261.
Type locality: “Fort-Naryne” [Kyrgyzstan].
Current status: unavailable name and synonym of P. (A.) ripartii colemani (after
susae (Bertaccini, 2003)
Original combination: Agrodiaetus ripartii susae
In: Bertaccini E (2003) Prima segnalazione in piemonte di Agrodiaetus ripartii (Freyer, 1831) e descrizione di A. ripartii susae ssp. nova (InsectaLepidopteraLycaenidae). Quoderno di Studi e Notizie di Storio Noturole dello Romogno 17: 127–138.
Type locality: “valle di susa (To) loc. Mompantero”, Italy.
Current status: synonym of P. (A.) ripartii ripartii.
tengritaghicus Koҫak & Kemal, 2001
Original combination: Polyommatus (Admetusia) tengritaghicus
In: Koҫak A, Kemal M (2001) Lepidoptera Cograpiyesi llstide tetqiqatlar. 2. Qazaqistan Kepinekliring Zoocograpiyesi ve Taksonomiyesi Llstide Tetqiqatlar. (Lepidoptera, Papilionoidea, Hesperioidea). Priamus 10: 111–163.
Type locality: Kazakhstan.
Current status: likely subspecies of P. (A.) ripartii.
timfristos Lukhtanov, Vishnevskaya & Shapoval, sp. n.
Original combination: Polyommatus timfristos
In the present paper.
Type locality: Greece, Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605 E, 1270 m.
Holotype in Zoological Institute of the Russian Academy of Science, St. Petersburg.
Current status: species.
urmiaensis Schurian & Ten Hagen, 2003
Original combination: Polyommatus (Agrodiaetus) urmiaensis
In: Schurian K, Ten Hagen W (2003) Polyommatus (Agrodiaetus) urmiaensis sp. n. aus Nordwestiran (Lepidoptera: Lycaenidae). Nachrichten des Entomologischen Vereins Apollo 24(1/2): 1–5.
Type locality: Iran, Azarbaygan-e Garbi, vic. Salamas, 60 km N of Orumieh, 1700–1800 m.
Holotype in Senckenberg Museum, Frankfurt am Main, Germany.
Current status: subspecies of P. (A.) karacetinae.
valiabadi (Rose & Schurian, 1977)
Original combination: Agrodiaetus rjabovi ssp. valiabadi
In: Rose K., Schurian K (1977) Beitraege zur Kenntnis der Rhopaloceren Irans. 7. Beitrag: Eine neue Unterart von Agrodiaetus rjabovi Forster. Journal of Entomological Society of Iran 4(1/2): 63.
Type locality: “Elburs-Nordseite (Chalus-Tal), Umgebung Vali-Abad, 1900- 2100 m NN, 25 km nördlich Kandevantunnel” [Iran: Elburs mts.].
Holotype in coll. K. Schurian, Schwalbach [Kelkheim] (after
Current status: species.
violetae (Gómez-Bustillo, Expósito & Martínez, 1979)
Original combination: Agrodiaetus violetae
In: Gómez-Bustillo M, Expósito HA, Martínez BP (1979): Una nueva especie para la Ciencia: Agrodiaetus violetae (Lep. Lycaenidae). Shilap Revista de Lepidopterología 7(1): 51.
Type locality: “Sierra de Almijara (a 1150 m.), Prov. de Málaga” [Spain: Malaga].
Holotype in coll. M. Gómez-Bustillo, Madrid [?] (after
Current status: species.
violetapunctata (Gómez-Bustillo, Exposìto & Martinéz, 1979)
Original combination: Agrodiaetus violetae f. violetapunctata
In: Gómez-Bustillo M, Expósito HA, Martínez BP (1979): Una nueva especie para la Ciencia: Agrodiaetus violetae (Lep. Lycaenidae). Shilap Revista de Lepidopterología 7(1): 53.
Type locality: “Sierra de Almijara 9°1150 m), Prov. de Málaga” [Spain].
Current status: synonym of P. (A.) violetae.
virgilius (Oberthür, 1910)
Original combination: Lycaena dolus race virgilia
In: Oberthür C (1910) Notes pour servir à établir la Faune Franҫaise et Algérienne des Lépidoptères (suite). Études de Lépidoptérologie Comparée 4(l): 263.
Type locality: “Italic méridionale . . . notamment à Sulmona” [Italy: Abruzzi e Molise: L'Aquila].
Lectotype in The Natural History Museum, London (after
Current status: subspecies of P. (A.) dolus.
vittatus (Oberthür, 1892)
Original combination: Lycaena dolus forma geographica vittata
In: Oberthür C (1892) Bulletin de la Société Entomologique de France, 1892: X.
Type locality: “Lozère” [France: Lozère].
Syntypes possibly in The Natural History Museum, London (after
Current status: subspecies of P. (A.) dolus.
yeranyani (Dantchenko & Lukhtanov, 2005)
Original combination: Agrodiaetus admetus yeranyani
In: Dantchenko A, Lukhtanov V (2005) New taxa of the brown species-complex of the genus Agrodiaetus Hübner, (1822) from Transcaucasia (Lepidoptera, Lycaenidae). Atalanta 35: 327–334, 472–475.
Type locality: Armenia, Zangezur mts, Kajaran distr., right bank Vokhtchi River, Pkhrut vic. 1900 m.
Type material: Museum of Comparative Zoology (Harvard University, Cambridge, MA, USA).
Current status: species.
Additional phylogenetic trees
Fragment of the ML tree of P. admetus and P. dolus complexes based on analysis of COI barcodes and focused on P. nephohiptamenos, P. admetus and P. ripartii pelopi. Polyommatus pseudorjabovi clade is not shown in details, for its composition see
Fragment of the ML tree of P. admetus and P. dolus complexes based on analysis of COI barcodes and focused on details in the structure of the West-European and the “mixed” (Eurasian) clades of P. ripartii. Numbers at nodes indicate bootstrap support.
Fragment of the ML tree based on analysis of COI barcodes and focused on details of the P. dolus group. Polyommatus rjabovianus and P. valiabadi clades are not shown in details, for their composition see
Fragment of the MP tree of P. admetus and P. dolus complexes based on analysis of COI barcodes and focused on P. nephohiptamenos, P. admetus and P. ripartii pelopi. Polyommatus pseudorjabovi clade is not shown in details, for its composition see
Fragment of the MP tree of P. admetus and P. dolus complexes based on analysis of COI barcodes and focused on details of the West-European and the “mixed” (Eurasian) clades of P. ripartii. Numbers at nodes indicate bootstrap support.
Habitats of the studied species
Habitat of P. admetus. Greece, Peloponnesse Peninsula, Mt. Chelmos, near Kalavrita, 800 m, 16 july 2008. Photo by V.A. Lukhtanov.
Habitat of P. admetus. Greece, Smolikas Mt, Konitsa, 950 m, 22 July 2008. Photo by V.A. Lukhtanov.
Habitat of P. admetus. W Bulgaria, near Dragoman, 700 m, 29 July 2008. Photo by V.A. Lukhtanov.
Habitat of P. ripartii pelopi. Greece, Peloponnesse Peninsula, Mt. Chelmos, near Kalavrita, 800 m, 17 July 2008. Photo by V.A. Lukhtanov.
Polyommatus nephohiptamenos. Northern Greece, Falakro Mt, near Granitis, 1700 m, 23 July 2008. Photo by V.A. Lukhtanov.
Habitat of P. nephohiptamenos. Northern Greece, Falakro Mt, near Granitis, 1700 m, 24 July 2008. Photo by V.A. Lukhtanov.
Habitat of P. nephohiptamenos. Northern Greece, Falakro Mt, near Granitis, 1700 m, 24 July 2008. Photo by V.A. Lukhtanov.
Habitat of P. aroaniensis in its type locality. Greece, Peloponnesse Peninsula, Mt. Chelmos, near Kalavrita, 1600 m, 16 July 2008. Photo by V.A. Lukhtanov.
Habitat of P. timfristos. Central Greece, Mt. Timfristos, near Karpenisi, 1200 m, 20 July 2008. Photo by V.A. Lukhtanov.
Habitat of P. timfristos. Central Greece, Mt. Timfristos, near Karpenisi, 1200 m, 20 July 2008. Photo by V.A. Lukhtanov.
Habitat of P. timfristos. Central Greece, Mt. Parnassos, 19 July 2008. Photo by V.A. Lukhtanov.
Habitat of P. timfristos. Central Greece, Mt. Parnassos, 19 July 2008. Photo by V.A. Lukhtanov.
Hvoyna, Bulgaria, type locality of P. orphicus orphicus, 2 July 2016. Photo by E. Pazhenkova.
Habitat of P. orphicus orphicus in its type locality. Bulgaria, Hvoyna, 3 July 2016. Photo by E. Pazhenkova.