Research Article |
Corresponding author: Ana C. G. Araujo ( ana-claudia.guerra@embrapa.br ) Academic editor: Natalia Golub
© 2018 Eliza F. de M. B. do Nascimento, Bruna V. dos Santos, Lara O. C. Marques, Patricia M. Guimarães, Ana C. M. Brasileiro, Soraya C. M. Leal-Bertioli, David J. Bertioli, Ana C. G. Araujo.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
do Nascimento EFMB, dos Santos BV, Marques LOC, Guimarães PM, Brasileiro ACM, Leal-Bertioli SCM, Bertioli DJ, Araujo ACG (2018) The genome structure of Arachis hypogaea (Linnaeus, 1753) and an induced Arachis allotetraploid revealed by molecular cytogenetics. Comparative Cytogenetics 12(1): 111-140. https://doi.org/10.3897/CompCytogen.v12i1.20334
|
Peanut, Arachis hypogaea (Linnaeus, 1753) is an allotetraploid cultivated plant with two subgenomes derived from the hybridization between two diploid wild species, A. duranensis (Krapovickas & W. C. Gregory, 1994) and A. ipaensis (Krapovickas & W. C. Gregory, 1994), followed by spontaneous chromosomal duplication. To understand genome changes following polyploidy, the chromosomes of A. hypogaea, IpaDur1, an induced allotetraploid (A. ipaensis × A. duranensis)4x and the diploid progenitor species were cytogenetically compared. The karyotypes of the allotetraploids share the number and general morphology of chromosomes; DAPI+ bands pattern and number of 5S rDNA loci. However, one 5S rDNA locus presents a heteromorphic FISH signal in both allotetraploids, relative to corresponding progenitor. Whilst for A. hypogaea the number of 45S rDNA loci was equivalent to the sum of those present in the diploid species, in IpaDur1, two loci have not been detected. Overall distribution of repetitive DNA sequences was similar in both allotetraploids, although A. hypogaea had additional CMA3+ bands and few slight differences in the LTR-retrotransposons distribution compared to IpaDur1. GISH showed that the chromosomes of both allotetraploids had preferential hybridization to their corresponding diploid genomes. Nevertheless, at least one pair of IpaDur1 chromosomes had a clear mosaic hybridization pattern indicating recombination between the subgenomes, clear evidence that the genome of IpaDur1 shows some instability comparing to the genome of A. hypogaea that shows no mosaic of subgenomes, although both allotetraploids derive from the same progenitor species. For some reasons, the chromosome structure of A. hypogaea is inherently more stable, or, it has been at least, partially stabilized through genetic changes and selection.
Chromosomes, DNA content, FISH, GISH, heterochromatic bands, LTR-retrotransposons, peanut, rDNA
The genus Arachis (Linnaeus, 1753) is native to South America, with Arachis as the largest botanical section. Most species in this section are diploids (2n = 2x = 20), but there are a few aneuploids and two tetraploids: A. hypogaea (Linnaeus, 1753), the cultivated peanut (groundnut) and A. monticola (Krapovickas & Rigoni, 1958) (2n = 4x = 40) (
Whereas the chromosomes of A. hypogaea are of mostly similar size and metacentric, cytogenetic analysis can distinguish two different genome components: the A subgenome comprising ten pairs of chromosomes, with the centromeres strongly stained by DAPI, including the small pair termed ‘A’ (
Cytogenetic analysis mainly reveals the faster evolving repetitive DNA sequences; therefore, it tends to emphasize the differences between the subgenomes in allopolyploids. On the other hand, observations using genetic mapping and genes in Arachis tended to detect the similarities between the subgenomes: high collinearity between A and B subgenomes has been shown by comparing genetic linkage maps and sequencing of homeologous regions (
An important step in the understanding the genetics of many crops has been obtained by whole genome sequencing. However, for A. hypogaea, the very high similarity of the subgenomes makes the characterization of its genome, at the whole genome level, very challenging, although various lines of evidence suggested that the progenitor genomes had undergone relatively few changes since polyploidization (
The availability of the genome sequences of two representatives of A. hypogaea diploid progenitor species, A. duranensis V14167 and A. ipaensis K30076, (
In addition to genetic recombination between A. hypogaea subgenomes, other genomic changes are likely to have occurred following what
Interestingly, the recent cytogenetic observations of
With the aim of understanding genome changes that have occurred after the polyploidization in A. hypogaea, a detailed comparative cytogenetic study of A. hypogaea, IpaDur1and progenitor diploid species is here presented. It was expected that the recently synthesized allotetraploid would undergo similar changes to those in A. hypogaea in the first years following polyploidization. Here is shown that IpaDur1 shows some alterations also observed in A. hypogaea, such as possible A genome nucleolar dominance, genome deletions and transposons activity. However, further alterations in IpaDur1, such as the smaller number of 45S rDNA loci and evident large-scale recombination between subgenomes in at least one chromosome pair of IpaDur1 were here evidenced. Current data contributes directly to the understanding of immediate effects of allotetraploidization in Arachis and to the overall understanding of Arachis genomes.
Seeds from the wild diploid species (2n = 20) A. duranensis, accession V14167 and A. ipaensis, accession K30076; the allotetraploids (2n = 40) A. hypogaea subsp. fastigiata var. fastigiata ‘IAC Tatu-ST’ (AABB) and the induced allotetraploid IpaDur1 (A. ipaensis K30076 × A. duranensis V14167)4x (
DNA content and size, CMA3+ bands and distribution of the in situ hybridization signals (GISH and FISH) on chromosomes of the four Arachis genotypes.
Genotypes | A. duranensis | A. ipaensis | IpaDur1 | A. hypogaea | |
---|---|---|---|---|---|
Karyotype formula | 9 m + 1 sm | 9 m + 1 sm | 18 m + 2 sm | 18 m + 2 sm | |
DNA content (2C) (pg) | 2.62 | 3.34 | 5.92 | 5.70 | |
Size (1C) (Gb | 1.28 | 1.63 | 2.89 | 2.79 | |
CV (%) | 2.67 | 4.14 | 2.36 | 3.25 | |
CMA 3 + | Proximal regions on cyt-A10* | Proximal region on cyt-B10* | Proximal region on cyt-A10* and cyt-B10 | Proximal regions on cyt-A10*, cyt-B10 and another three pairs | |
GISH (genomic probes) | IpaDur1 | – | – | On all chromosomes, for both subgenomes. Few signals on centromeres of A subgenome chromosomes and terminal regions. Cyt-B10 entirely covered by signals | On all chromosomes, for both subgenomes. Seldom signals on cyt-A9. Few signals on centromeres of A subgenome chromosomes and terminal regions. Cyt-B10 entirely covered by signals |
A. hypogaea | – | – | On all chromosomes, for both subgenomes. Seldom signals on cyt-A9. Few signals on centromeres of A subgenome chromosomes and terminal regions. Cyt-B10 with alternated pattern | On all chromosomes, of both subgenomes. Seldom signals on cyt-A9. Few signals on centromeres of A subgenome chromosomes and terminal regions. Cyt-B10 entirely covered by signals | |
A. duranensis and A. ipaensis | – | – | Higher affinity to chromosomes of each corresponding subgenome. Hybridized poorly on cyt-A9, centromeres of A chromosomes and terminal regions of all chromosomes. Cyt-B10 with mosaic pattern | Higher affinity to chromosomes of each corresponding subgenome. Hybridized poorly on cyt-A9, centromeres of A chromosomes and terminal regions of all chromosomes. Cyt-B10 with higher affinity to A. ipaensis probe | |
rDNA FISH | 5S | Proximal region on cyt-A3 | Proximal region on cyt-B3 | Interstitial region on cyt-A3 and proximal region on cyt-B3 | Interstitial region on cyt-A3 and proximal region on cyt-B3 |
45S | Proximal region on cyt-A2 and A10* | Proximal region on cyt-B3 and B10* and on terminal region on cyt-B7 | Proximal region on cyt-A2; A10* and B10 | Proximal regions on cyt-A2; A10*; B3 and B10 and in terminal regions on cyt-B7 | |
LTR-RT FISH | RE128-84 | Dispersed on arms and proximal regions of all chromosomes. Seldom detected on centromeric and terminal regions | Dispersed on the arms and proximal regions of most chromosomes. Lacking on two pairs. Seldom detected on centromeric and terminal regions | Dispersed on the arms and proximal regions of most chromosomes. Lacking on one pair of chromosome of the subgenome A Seldom detected on centromeric and terminal regions | Dispersed on arms and proximal regions of most chromosomes. Lacking on cyt-A9 and cyt-A10. Seldom detected on centromeric and terminal regions |
LTR-RT FISH | Pipoka | Dispersed on arms and proximal regions of most chromosomes. Poorly on cyt-A9 and cyt-A10. Seldom detected on centromeric and terminal regions | Dispersed on the arms and proximal regions of most chromosomes. Seldom detected on centromeric and terminal regions | Dispersed on the arms and proximal regions of most chromosomes. Lacking on cyt-A9, cyt-A10 and on two pairs of A subgenome. Seldom detected on centromeric and terminal regions | Dispersed on the arms and proximal regions of few chromosomes. Lacked on cyt-A9, cyt-A10. Seldom detected on centromeric and terminal regions |
Athena | Dispersed on arms and proximal regions of most chromosomes. Seldom on centromeric and terminal regions | Dispersed on the arms and proximal regions of most chromosomes Lacking on terminal regions of all chromosomes | Dispersed on the arms and proximal regions of most chromosomes on B subgenome. Lacking on cyt-A9 and cyt-A10. Seldom detected on centromeric and terminal regions | Dispersed on the arms and proximal regions of most chromosomes, Lacking on cyt-A9 and cyt-A10. Seldom detected on centromeric and terminal regions |
Genome sizes were estimated using the CyFlow Space system (Sysmex Partec GmbH, Görlitz, Germany), with leaf cells labeled with propidium iodide, as described by
Meristem cells from root tips were isolated to obtain metaphase chromosome spreads. Root tips were collected from at least five different plants, of each genotype, then fixed in ethanol: glacial acetic acid (3:1v/v) solution for 60 min at 4 °C and finally digested with 2 % cellulase and 20 % pectinase (
Slides containing metaphase spreads were stained with DAPI (4’, 6-diamino-2-phenylindole; 2 µg/ml) to determine the presence of heterochromatic bands (AT-rich regions). The chromosomes were analyzed using the epifluorescent Zeiss AxioPhot photomicroscope (Zeiss, Oberkochen, Germany), with the corresponding DAPI fluorescent filter. Images were captured using the Zeiss AxioCam MRc digital camera (Carl Zeiss Light Microscopy, Göttingen, Germany) and Axiovision Rel. 4.8 software (https://www.zeiss.com/microscopy/int/products/microscope-software/axiovision.html). Images were acquired and further analyzed using the Adobe Photoshop CS software, applying only functions, except cropping, that affect the whole image equally.
For CMA3 banding, the nuclear dye chromomycin A3 (CMA3, Sigma Aldrich) was used following
Genomic DNA from all four genotypes was isolated according to the CTAB protocol (
GISH was performed according to
For single GISH, metaphase spreads of IpaDur1were hybridized with the A. hypogaea probe. After analysis and images acquisition, the A. hypogaea probe and DAPI stain were removed (
For double GISH, approximately 50 ng/µl/slide of each diploid labeled DNA was used concomitantly. Slides were hybridized as above described, with no blocking DNA. Detection of hybridization sites, DAPI counterstaining, analysis and images acquisition were conducted as described above.
The ribosomal sequences (rDNA) coding for 5S and 45S (18S-5.8S-25S) of Lotus japonicus (Regel) K. Larsen, 1955 (
The LTR retrotransposon families, RE128-84 (Genbank KF729744.1; KF729735.1; KC608796.1; KC608788.1), representing the Ty1-copia group; Pipoka (Genbank KF729742.1 and KC608774.1) from Ty3-gypsy and Athena (Genbank KC608817.1), a non-autonomous transposon (which lacks the reverse transcriptase coding sequence) were chosen as the representatives of the most abundant LTR-retrotransposon families, and amongst the most and least frequent LTR-retrotransposons in A. duranensis and A. ipaensis genomes. DNA corresponding to the sequence coding for the reverse transcriptase enzyme of RE128-84 (Revtrans-RE) and Pipoka (Revtrans-PIP) were used to obtain the probes for FISH. Since Athena family comprises non-autonomous elements, there is no DNA sequence coding for the reverse transcriptase enzyme. Therefore, a non-genic, internal conserved DNA sequence, specific to the Athena family (Conserved-Ath) was used to obtain Athena probe. DNAs were PCR-amplified and the size of the amplicons confirmed in 1 % (w/v) agarose gel. DNAs were then purified and sequenced. Each DNA was labeled with either digoxigenin-11-dUTP or Cy3-dUTP by Nick Translation (Roche Diagnostics Deutschland GmbH). Primers, sizes of the amplicons and the sequences are listed in Table
Characteristics of the LTR-retrotransposon families, RE128-84; Pipoka and Athena. Conserved DNA sequence used as probes; transposition autonomy character; superfamily; primers for amplification; sequences, sizes and names of the amplified DNA.
RT-LTR | Superfamily | Primers | Name and fragment size (bp) | DNA conserved sequences |
Athena non-autonomous | - |
Athena-FWD CCATCATAATTATCATAGTTGTGG Athena-REV CTCCAAACCAAGAGGGTGATAAC |
Conserved-Ath 618 | TTATGGAAAGGAAGGGATCCCATAACTCATCCCAAGTCAAGGTTTCATTACGTTTTAAACCACTTTTTCATCAATTTTGAGTCTTACTTGTTTATATTAGATACATAGTTCTTTTATTCCTTCATTAGTTTATTAATTACAATTTTGCCTTGTTCTTTTATCTCTTTATTGTTTACTTCAAACATTGAAAACCCTTTTGATCTTCACAACCAATTTTATGCACTTGTTGTCACTAGTTCCTAGGGAGAACAAATACTCTCGGTATATATATTTGCTTTGAATTGTGACAATCTTTAGAGTAATAATTTGACTATTGGCCAATTGTTGGTTCGAAGCTATACTTGCAACGAAGATCTATTTGGAGAAAATTCCAACCTACAATTTGGTCTTTGTCAAATTTTGGCGCCGTTGCCGGGGAGCTAATGTCATGAGTGCTATATTTTGGTTGTTGTAAATATGTCCATAGTATGAATAGATACTTTTTGGTTGCTTGTTTATTTTTGTTGGTAATTAGGATTTTGTTTATTTTGTTAATTGATGTCTTTAGTTGTTATTTTCAATTTTCTCTATGA |
RE128-84 autonomous | Ty1-Copia | RE128-84-FWD CCACTAGATCCTCAAGCAAG RE128-84-REV AGAAGGCACTAAGCCTTTC |
Revtrans-RE 558 | AGCAAGAAGCAAGTAGAACCGAGCAATGTTGCCTTCTTGTCCCAATTGGAGCCTCTCAATGTGAAACAAGATCTTGAAGACCCCTCATGGGTTAAAGCCATGGAAAAAGAGCTGGCACAATTTGAAAAGAATGAGGTGTGGACACTTGTACCAAATCCAAATGATAAGAAGGTAACCGGTACAAGGTGGATTTTTAAAAATAAATTGGTTGAGGATGGTAGTGTTGTTCGTAACAAGGCTAGATTAATGGCCCAAGGTTACGATCAAGAAGAAGGAATTGATTTTGATGAGTCATTTTCCCCGGTAGCTAGAATGGAAGCAATTAGGTTGCTTCTTGCCTATGCTGCCCACAAGGGTTTTCAAGATGTTCCAAATGGATGTCAGATGTGCATTCCTTAATGGTTTTATAGATAGGGAAGTATTTGTGACTCAACCCCTCGGTTTTGAAAGTAAAGAATTTCCAAACCATGTTTTTAAATTATCAAAGGCTCTTTATGGCCTTAGGCAAGCTCCAAGAGCTCGGTAT |
Pipoka autonomous | Ty3-Gypsy | Pipoka-FWD CCACATTGCTTTAGAGGATC Pipoka-REV GCTTGTCAAAAGCCTCCATGC |
Revtrans-Pip 535 | AAGAAAAAACAACCTTTACATGCCCCTTTGGCACTTATGCCTACAAGCGTATGCCATTTGGCTTATGCAACGCACCGGTAACTTTCCAAAGGTGTATGATGAGCATATTTGCAGATCTTCAAGAGCATTGGATGGAGGTGTTCATGGACGATTTTAGTGTCTATGGGGACTCTTTTGATCTTTGCTTGGACAACCTTGCAAAAGTGTTGGAGAGGTGTACTAAAACAAATATTGTCTTAAATTTTGAGAAGTGTCATTTTATGGTTAGACAAGGTATTGTTTTAGGACACATTATCTCTAACGATGGTATTTCTATGGATCCAGCAAAGATAAATGTTATATCTAGTTTACCTTACCCCTCCTCCGAGAGGGAAGTCCGTGCGTTCCTTGGACATACAGGTTTTTACTGGTGATTTATTAAGGACTTTAGCAAGGTGGCATTACCTCTATCTTGATTGTTGCAAAAAGACGTTGAATTTGATCGAAGCAAAGAGT |
The conserved DNA sequences specific for each LTR-retrotransposon family (Table
These conserved DNA sequences from each LTR-retrotransposon family were used as queries to assess their distribution in the chromosomal pseudomolecules, of both diploid species, using the PeanutBase BLAT tool (http://www.peanutbase.org). The match score was set to ≥ 80 %. Data was manually curated to remove sequences with different size than the expected one (Table
The DNA content estimated by flow cytometry revealed that IpaDur1 had a value very close to the sum of those of A. duranensis and A. ipaensis, however, slightly different from that of A. hypogaea (Table
IpaDur1 harbored 40 chromosomes, with similar morphology to those chromosomes of A. hypogaea and their progenitors, A. ipaensis and A. duranensis, being mostly metacentric (36 m + 4 sm), with the two submetacentric pairs of chromosomes designated as cyt-A10 and cyt-B10, both SAT chromosomes (Table
Metaphase chromosome spreads from root tips after DAPI staining (bright white) of A IpaDur1 B A. hypogaea C A. duranensis and D A. ipaensis. Chromosomes of the A subgenome (green arrows) and B subgenome (red arrows). Cyt-A9 (A9). Whenever the secondary constriction on cyt-A10 and cyt-B10 is extended, forming the thread-like constriction; the short arm and the proximal segment of the long arm are indicated by an asterisk (*) and the separated satellite is marked by a degree sign (°). Bar = 5μm.
GISH with the allotetraploid genomic probes
Genomic in situ hybridization used either A. hypogaea or IpaDur1 labeled genomic DNA as the probe (single GISH). Hybridization with IpaDur1 or A. hypogaea probes indicated a similar and overall affinity of both probes to all chromosomes of IpaDur1, except for the signals on cyt-A9 (equivalent to Aradu.A08;
Single GISH on IpaDur1 (A, B, C) and A. hypogaea (D, E, F) chromosomes, followed by DAPI counterstaining (blue C, F). Hybridization with the genomic probe of IpaDur1 A, E A. hypogaea probe B, D and C overlapping of DAPI and A. hypogaea probe on IpaDur1 chromosomes F overlapping of DAPI and IpaDur1 probe on A. hypogaea. Cyt-A9 (A9), CytB-10 (B10). Insets of cyt-B10 of IpaDur1 (A, B, C) showing alternate dark and light bands. When the secondary constriction on cyt-A10 is extended, forming the thread-like constriction, the short arm and the proximal segment of the long arm are indicated by an asterisk (*) and the separated satellite is marked by a degree sign (°). Bar = 5μm.
GISH with the diploid genomic probes
Simultaneous hybridization with A. duranensis and A. ipaensis genomic probes (double GISH) confirmed that each diploid probe hybridized preferentially with the chromosomes of its corresponding subgenome, for both IpaDur1 and A. hypogaea. IpaDur1 showed evident hybridization on all chromosomes, as single or overlapping signals (one or both probes hybridizing to the same region of the chromosome, respectively), except for cyt-A9; centromeres of A subgenome chromosomes and terminal chromosomal regions, which hybridized poorly (Fig.
Double GISH on IpaDur1 (A, B, C) and A. hypogaea (D, E, F) chromosomes, followed by DAPI counterstaining (blue C, F). Hybridization with the genomic probe of A. duranensis (red A, D) and A. ipaensis (green B, E). Overlapping of DAPI and both diploid probes on C IpaDur1 and on F A. hypogaea. Cyt-A9 (A9), cyt-B10 (B10). Insets of IpaDur1 cyt-B10 (A, B, C), showing a colored mosaic. When the secondary constriction on cyt-A10 is extended, forming the thread-like constriction, the short arm and the proximal segment of the long arm are indicated by an asterisk (*) and the separated satellite is marked by a degree sign (°). Bar = 5μm.
Strikingly, a distinct intercalated mosaic-banding pattern was also observed on the pair of chromosomes cyt-B10: bands with higher affinity to A. duranensis genomic probe (Fig.
A. hypogaea chromosomes showed patterns similar to those observed in IpaDur1 after double GISH, except cyt-B10 that showed uniform hybridization signals along the chromosomes (Fig.
The number of 5S rDNA loci was an additive character for both IpaDur1 and A. hypogaea: one locus on the cyt-A3, originating from the corresponding chromosome in A. duranensis, and another locus on cyt-B3, from the corresponding chromosome in A. ipaensis (Fig.
A IpaDur1 and B A. hypogaea chromosomes hybridized with the 5S rDNA probe (green) and 45S (red), followed by DAPI counterstaining (bright white). Cyt-A2 (A2), cyt-A3 (A3), cyt-B3 (B3), cyt-B7 (B7) and cyt-B10 (B10). A. hypogaea cyt-B3 with the co-localization of 5S and 45S rDNA signals. When the secondary constriction on cyt-A10 is extended, forming the thread-like constriction, the short arm and the proximal segment of the long arm are indicated by an asterisk (*) and the separated satellite is marked by a degree sign (°). Bar = 5μm.
Mitotic metaphase chromosome hybridized with the 5S rDNA probe (green A, B) and 45S rDNA probe (red C, D), followed by DAPI counterstaining (bright white). A A. duranensis (2n = 2x = 20) showing signals on cyt-A3 (A3) B A. ipaensis (2n = 2x = 20) showing signals on cyt-B3 (B3) C A. duranensis with signals on cyt-A2 (A2) and cyt-A10 (A10) D A. ipaensis showing signals on cyt-B3, B7 and B10. When the secondary constriction on chromosome 10 is extended, forming the thread-like constriction, the short arm and the proximal segment of the long arm are indicated by an asterisk (*) and separated satellite is marked by a degree sign (°). Bar = 5μm.
Considering the FISH with the 45S rDNA probe, there were only three loci in IpaDur1 and five A. hypogaea, thus being an addictive character only for the latter. In IpaDur1 (Fig.
RE128-84
In all genotypes, the RE128-84 signals were preferentially dispersed on proximal regions and along the arms of the chromosomes, and seldom detected on centromeric and terminal regions. For both allotetraploids (Fig.
IpaDur1 (A, E, I), A. hypogaea (B, F, J), A. duranensis (C, G, K) and A. ipaensis (D, H, L) chromosomes hybridized with the LTR-retrotransposon probes RE-128-84 (A, B, C, D), Pipoka (E, F, G, H) and Athena (I, J, K, L), followed by DAPI counterstaining (blue). Cyt-A9 (A9). Chromosomes lacking signals (arrow). When the secondary constriction on cyt-A10 is extended, forming the thread-like constriction, the short arm and the proximal segment of the long arm are indicated by an asterisk (*) and the separated satellite is marked by a degree sign (°). Bar = 5μm.
Pipoka
As for RE128-84, Pipoka signals observed were spread along the chromosomes, except on centromeric and terminal regions. The majority of the IpaDur1 chromosomes showed signals (Fig.
Athena
In a similar way, chromosomes of all genotypes had Athena dispersed signals that lacked on centromeric and terminal regions. The abundance of signals in IpaDur1 seemed to be lower than in A. hypogaea (Fig.
The coverage of the LTR-retrotransposons indicated that these elements covered for RE128-84 family, around 1.20 % and 1.17 % of the A. duranensis and A. ipaensis chromosomal pseudomolecules, respectively, for Pipoka, 2.81 % and 6.09 % and for Athena, 0.77 % and 1.19 %. These three families covered about 4.68 % and 8.44 % of A. duranensis and A. ipaensis, mostly due to the large abundance of Pipoka members (Table
In silico coverage of the LTR-retrotransposons on the chromosomal pseudomolecules of A. duranensis and A. ipaensis (accordingly to www.peanutbase.org).
Frequency of LTR-retrotransposons (%) | ||||
---|---|---|---|---|
Pseudomolecule | RE128-84 | Pipoka | Athena | Total/ pseudomolecule |
Aradu.A01 (≅ 107 Mb) | 1.14 | 3.42 | 0.96 | 5.51 |
Aradu.A02 (≅ 93 Mb) | 1.28 | 2.62 | 0.52 | 4.42 |
Aradu.A03 (≅ 135 Mb) | 1.12 | 2.76 | 0.74 | 4.62 |
Aradu.A04 (≅ 123 Mb) | 1.35 | 2.90 | 0.58 | 4.83 |
Aradu.A05 (≅ 110 Mb) | 1.17 | 2.49 | 0.59 | 4.25 |
Aradu.A06 (≅ 112 Mb) | 1.10 | 2.99 | 0.66 | 4.75 |
Aradu.A07 (≅ 79 Mb) | 1.38 | 2.37 | 0.64 | 4.38 |
Aradu.A08 (≅ 49 Mb) | 1.67 | 0.85 | 0.25 | 2.76 |
Aradu.A09 (≅ 120 Mb) | 1.08 | 3.24 | 0.73 | 5.06 |
Aradu.A10 (≅ 109 Mb) | 1.09 | 3.20 | 0.75 | 5.05 |
Total in A genome (1.25 Gb) | 1.20 | 2.81 | 0.77 | 4.68 |
Araip.B01 (≅ 137 Mb) | 1.07 | 6.54 | 1.27 | 8.89 |
Araip.B02 (≅ 108 Mb) | 1.30 | 5.22 | 1.09 | 7.61 |
Araip.B03 (≅ 135 Mb) | 1.21 | 4.75 | 0.97 | 6.93 |
Araip.B04 (≅ 133 Mb) | 1.26 | 6.03 | 1.05 | 8.34 |
Araip.B05 (≅ 149 Mb) | 1.09 | 6.40 | 1.28 | 8.77 |
Araip.B06 (≅ 137 Mb) | 1.03 | 5.76 | 1.09 | 7.89 |
Araip.B07 (≅ 126 Mb) | 1.09 | 7.61 | 1.32 | 10.01 |
Araip.B08 (≅ 129 Mb) | 1.35 | 6.08 | 1.25 | 8.67 |
Araip.B09 (≅ 147 Mb) | 1.20 | 5.91 | 1.25 | 8.36 |
Araip.B10 (≅ 136 Mb) | 1.10 | 6.49 | 1.25 | 8.84 |
Total in B genome (1.56 Gb) | 1.17 | 6.09 | 1.19 | 8.44 |
Accordingly, the number of LTR-retrotransposon hits after the LTR-retrotransposons in silico mapping on the diploid pseudomolecules were higher in A. ipaensis than in A. duranensis (Fig.
In silico mapping of the LTR-retrotransposon families, RE128-84, Pipoka and Athena on the chromosomal pseudomolecules of A. duranensis (left) and A. ipaensis (right).
The distribution of the LTR-retrotransposons, both in silico and in situ showed general similar patterns for the RE128-84 and Athena in A. duranensis; Pipoka in A. ipaensis and Athena, for both diploid genomes. The results shared by these two approaches enabled the inference of putative assignments by numbers for some of the IpaDur1 chromosomes, based on the abundance of hits on the numbered pseudomolecules (www.peanutbase.org). For example, A. duranensis chromosomal pseudomolecule Aradur.A04 had the largest number of RE128-84 hits; therefore, the chromosomes with more abundance of RE128-84 in situ hybridization signals in IpaDur1 could be putatively assigned as cyt-A4. In this same way, the pseudomolecule Araip.B02 was the one with the highest number of RE128-84 hits in A. ipaensis, thus the pair of chromosomes with more abundance of in situ signals would be called cyt-B2. Additionally, Araip.B07 had more Pipoka hits; therefore, the putative corresponding chromosome would be the cyt-B7. Aradur.A05 and Aradur.A08 pseudomolecules had no Athena hits, thus the corresponding chromosomes lacking in situ signals would be cyt-A5 and cyt-A9.
Cultivated peanut (A. hypogaea) is an allotetraploid with an AABB type genome, originated from the diploid progenitor wild species A. duranensis (A genome; female progenitor) and A. ipaensis (B genome; male donor) (
However, considering the behavior of other polyploids in general, it seemed that some changes following polyploidy were extremely likely to have occurred. Accordingly, comparisons at the genome sequence level have shown some recombination between the subgenomes of A. hypogaea and evidence of the A subgenome erosion by gene conversion with the B subgenome (
In this study, in order to investigate genome structure alterations, cytogenetics was used to make a detailed comparison of A. hypogaea, an induced allotetraploid IpaDur1 [(A. ipaensis K30076 × A. duranensis V14167)4x] and their progenitor species, A. duranensis and A. ipaensis. The use of an induced allotetraploid is advantageous because this hybrid approximates an early A. hypogaea, and it was expected to undergo similar changes to those that peanut underwent in the early generations following polyploidy, although A. duranensis was the male progenitor in IpaDur1 and the female in A. hypogaea. Furthermore, comparisons are more accurate, because the exact diploid progenitors are known, and both have their reference genome sequences available.
The sum of the estimated genome sizes of the diploid species, herein using the flow cytometry was very similar to the one estimated for IpaDur1, but somewhat larger (4 %) than the one estimated for A. hypogaea (Table
Current analysis indicates that A. hypogaea and IpaDur1 share many similarities derived from the progenitor diploids, however variations relative to progenitors were also cytogenetically revealed during this study. Chromosomes of IpaDur1 are morphologically similar to those of A. hypogaea (
Double GISH using simultaneously both labeled genomic DNAs from the diploid species as probes and, the single GISH using separately each of the allotetraploid genomic labeled DNA as probe were used to study the overall affinities of the genomes, especially considering the known biases of hybridization kinetics related to DNA repetitive fractions. Our hybridizations generated patterns generally consistent with previous observations in A. hypogaea (
Hybridizations with ribosomal DNAs (rDNAs) probes were carried out since they generate strong signals, the positions of ribosomal loci are important landmarks for cytogenetic chromosome identification and it is known that their concerted evolution drives changes following polyploidy (
Generally, 45S rDNA loci inherited from both parents often remain structurally (not necessarily functionally) intact in first generation hybrids, and ancient allopolyploids usually display uniparental inheritance and / or structural rearrangements of parental 45S rDNA (
Chromosome cyt-A10 of IpaDur1 (Fig.
Differences in the repetitive content created, for example, by the activation of transposons, following polyploidy could explain why the variation of the intensity of signals on A. hypogaea chromosomes hybridized to its own genomic probe and IpaDur1 probe. In this regard, distribution of three retroelements from different classes was further inspected, both in situ and in silico: the Ty1-copia transposon RE128-84, the Ty3-gypsy transposon Pipoka, and the non-autonomous Athena (Fig.
Overall, in this study, whilst there are some indications that genome changes have occurred after polyploidy in A. hypogaea, they are quite small: possible nucleolar dominance and genome deletions, and indications of transposon activity. Whilst recombination between subgenomes has been clearly shown by the sequence analysis in A. hypogaea (
It seems that IpaDur1 has a more unstable genome, and had larger recombination between subgenomes than A. hypogaea. IpaDur1 might be undergoing, at least in part, a route of ‘autotetraploidization’ and genetic degradation, process that has been termed the “Polyploid Ratchet” (
The authors thank Drs. J. F. M. Valls, M. T. Pozzobon, M.C. Moretzsohn for seed supply, technical support, and useful discussions; Ana C. Gomes for laboratory support; Leandro Mesquita, for greenhouse assistance; the Plant Cytogenetics and Evolution Laboratory at the Federal University of Pernambuco (UFPE), PE, Brazil for FaCS use and rDNA stabs and Artur Fonseca for the flow cytometry analysis; A. Pedrosa from UFPE, PE, Brazil for the plasmids with the rDNA sequences.