Data Paper |
|
Corresponding author: Irina Bakloushinskaya ( irina.bakl@gmail.com ) Academic editor: Vladimir Lukhtanov
© 2019 Irina Bakloushinskaya, Elena A. Lyapunova, Abdusattor S. Saidov, Svetlana A. Romanenko, Patricia C.M. O’Brien, Natalia A. Serdyukova, Malcolm A. Ferguson-Smith, Sergey N. Matveevsky, Aleksey S. Bogdanov.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Bakloushinskaya I, Lyapunova EA, Saidov AS, Romanenko SA, O’Brien PCM, Serdyukova NA, Ferguson-Smith MA, Matveevsky S, Bogdanov AS (2019) Rapid chromosomal evolution in enigmatic mammal with XX in both sexes, the Alay mole vole Ellobius alaicus Vorontsov et al., 1969 (Mammalia, Rodentia). Comparative Cytogenetics 13(2): 147-177. https://doi.org/10.3897/CompCytogen.v13i2.34224
|
Evolutionary history and taxonomic position for cryptic species may be clarified by using molecular and cytogenetic methods. The subterranean rodent, the Alay mole vole Ellobius alaicus Vorontsov et al., 1969 is one of three sibling species constituting the subgenus Ellobius Fischer, 1814, all of which lost the Y chromosome and obtained isomorphic XX sex chromosomes in both males and females. E. alaicus is evaluated by IUCN as a data deficient species because their distribution, biology, and genetics are almost unknown. We revealed specific karyotypic variability (2n = 52–48) in E. alaicus due to different Robertsonian translocations (Rbs). Two variants of hybrids (2n = 53, different Rbs) with E. tancrei Blasius, 1884 were found at the Northern slopes of the Alay Ridge and in the Naryn district, Kyrgyzstan. We described the sudden change in chromosome numbers from 2n = 50 to 48 and specific karyotype structure for mole voles, which inhabit the entrance to the Alay Valley (Tajikistan), and revealed their affiliation as E. alaicus by cytochrome b and fragments of nuclear XIST and Rspo1 genes sequencing. To date, it is possible to expand the range of E. alaicus from the Alay Valley (South Kyrgyzstan) up to the Ferghana Ridge and the Naryn Basin, Tien Shan at the north-east and to the Pamir-Alay Mountains (Tajikistan) at the west. The closeness of E. tancrei and E. alaicus is supported, whereas specific chromosome and molecular changes, as well as geographic distribution, verified the species status for E. alaicus. The case of Ellobius species accented an unevenness in rates of chromosome and nucleotide changes along with morphological similarity, which is emblematic for cryptic species.
speciation, hybridization, chromosome painting, cytochrome b gene, nuclear XIST and Rspo1 genes, Robertsonian translocations, synaptonemal complex, Ellobius
An origin of species due to chromosome changes is still debatable (
The genus Ellobius divides into two subgenera: Bramus Pomel, 1892 and Ellobius Fischer, 1814 (Musser, Carleton 2005). The subgenus Bramus includes two species: E. fuscocapillus Blyth, 1843 (2n = 36, XX♀–XY♂), and E. lutescens Thomas, 1897 (2n = 17, X0♀-X0♂) (
The northern mole vole, E. talpinus, with 2n = NF = 54 (
We studied the G-band structure of the E. alaicus karyotype previously and described a morphological homology for one pair of large metacentrics of the species to the Robertsonian metacentrics of E. tancrei from the Pamir-Alay (
The main objectives of this study were to reveal the chromosomal variability in E. alaicus and prove species affiliations for mole voles from adjacent to the Alay Valley territories of the Inner Tien-Shan and the Pamir-Alay Mountains. To bring a phylogenetic framework to the delimiting species, we examined the phylogeny of the subgenus Ellobius using the mitochondrial DNA marker, complete cytochrome b gene, cytb, and two nuclear DNA markers, fragments of the XIST (X-inactive specific transcript) and Rspo1 (R-spondin 1) genes.
We analyzed karyotypes or cytb structure, or both, of 116 specimens of E. alaicus and E. tancrei mole voles from 27 localities across the Alay Valley and adjacent territories, as well as 7 E. talpinus specimens from 6 localities of Russia (Fig.
The geographic location of studied populations of the mole voles E. alaicus (dark triangles) and E. tancrei (dark spots). Localities are numbered as in Table
List of studied specimens, species, origin/locality, sex, 2n, cytb accession numbers.
| No | Species | 2n | Voucher # | Sex | Loc. # | Locality | Coordinates | Year | GenBank # |
|---|---|---|---|---|---|---|---|---|---|
| 1 | E. alaicus | – | S132131* | ♂ | 1 | Kyrgyzstan. The Alay Valley, 10 km to the North from the Sary-Tash, the Taldyk pass, 3500 m above sea level | 39°46'N 73°10'E | 1983 | MG264319 |
| 2 | E. alaicus | – | S132133* | ♀ | 1 | Kyrgyzstan. The Alay Valley, 10 km to the North from the Sary-Tash, the Taldyk pass, 3500 m above sea level | 39°46'N 73°10'E | 1983 | MG264320 |
| 3 | E. alaicus | – | S132135* | ♀ | 1 | Kyrgyzstan. The Alay Valley, 10 km to the North from the Sary-Tash, the Taldyk pass, 3500 m above sea level | 39°46'N 73°10'E | 1983 | MG264321 |
| 4 | E. alaicus | – | S132130* | ♂ | 2 | Kyrgyzstan. The Alay Valley, close to Daraut-Korgon settlement, 2160 m above sea level | 39°33'N 72°15'E | 1983 | MG264318 |
| 5 | E. alaicus × E. tancrei hybrid | 53 | 20757 | ♂ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 6 | E. alaicus | 52 | 20758 | ♂ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 7 | E. alaicus × E. tancrei hybrid | 53 | 20759 | ♂ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 8 | E. alaicus | 52 | 20760 | ♂ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 9 | E. alaicus | 52 | 20764 | ♂ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 10 | E. alaicus | 52 | 20765 | ♀ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 11 | E. alaicus | 52 | 20766 | ♂ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 12 | E. alaicus × E. tancrei hybrid | 53 | 20778 | ♂ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 13 | E. alaicus | 52 | 20779 | ♀ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 14 | E. alaicus | 52 | 20780 | ♀ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 15 | E. alaicus | 52 | 20788 | ♂ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 16 | E. alaicus | 52 | 20789 | ♀ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 17 | E. alaicus | 52 | 20790 | ♀ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 18 | E. alaicus | 52 | 20791 | ♂ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 19 | E. alaicus | 52 | 20792 | ♂ | 3 | Kyrgyzstan. Pamir Highway, Osh – Gul’cha. 20 km to Gul’cha, the beginning of the ascent to the pass, 1500 m above sea level | 40°15'N 73°20'E | 1983 | – |
| 20 | E. alaicus | 52 | 21054 | ♂ | 4 | Kyrgyzstan. Close to the lake Chatyr-Kel', the 522 km from Bishkek city | 40°33'N 75°17'E | 1983 | – |
| 21 | E. alaicus | 51 | 21055 | ♀ | 4 | Kyrgyzstan. Close to the lake Chatyr-Kel', the 522 km from Bishkek city | 40°33'N 75°17'E | 1983 | – |
| 22 | E. alaicus | 52 | 21056 | ♂ | 4 | Kyrgyzstan. Close to the lake Chatyr-Kel', the 522 km from Bishkek city | 40°33'N 75°17'E | 1983 | – |
| 23 | E. alaicus | 52 | 21057 | ♂ | 4 | Kyrgyzstan. Close to the lake Chatyr-Kel', the 522 km from Bishkek city | 40°33'N 75°17'E | 1983 | – |
| 24 | E. alaicus | 52 | 21058 | ♀ | 4 | Kyrgyzstan. Close to the lake Chatyr-Kel', the 522 km from Bishkek city | 40°33'N 75°17'E | 1983 | – |
| 25 | E. alaicus | 51 | 21084 | ♂ | 4 | Kyrgyzstan. Close to the lake Chatyr-Kel', the 522 km from Bishkek city | 40°33'N 75°17'E | 1983 | – |
| 26 | E. alaicus | 52 | 21085 | ♂ | 4 | Kyrgyzstan. Close to the lake Chatyr-Kel', the 522 km from Bishkek city | 40°33'N 75°17'E | 1983 | – |
| 27 | E. alaicus | 51 | 21086 | ♀ | 4 | Kyrgyzstan. Close to the lake Chatyr-Kel', the 522 km from Bishkek city | 40°33'N 75°17'E | 1983 | – |
| 28 | E. alaicus | 52 | 21066 | ♀ | 5 | Kyrgyzstan. The Aksay River Valley, 4 km to the south-west from the Aksay settlement | 40°14'N 73°20'E | 1983 | – |
| 29 | E. alaicus | 52 | 21067 | ♀ | 5 | Kyrgyzstan. The Aksay River Valley, 4 km to the south-west from the Aksay settlement | 40°14'N 73°20'E | 1983 | – |
| 30 | E. alaicus | 52 | 21083 | ♀ | 5 | Kyrgyzstan. The Aksay River Valley, 4 km to the south-west from the Aksay settlement | 40°14'N 73°20'E | 1983 | – |
| 31 | E. alaicus | 52 | 21049 | ♂ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 32 | E. alaicus | 52 | 21050 | ♀ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 33 | E. alaicus | 52 | 21051 | ♀ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 34 | E. alaicus | 52 | 21052 | ♂ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 35 | E. alaicus | 51 | 21053 | ♀ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 36 | E. alaicus | 52 | 21069 | ♀ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 37 | E. alaicus | 51 | 21070 | ♀ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 38 | E. alaicus | 52 | 21071 | ♂ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 39 | E. alaicus | 50 | 21087 | ♂ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 40 | E. alaicus | 51 | 21088 | ♂ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 41 | E. alaicus | 50 | 21089 | ♂ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 42 | E. alaicus | 52 | 21090 | ♀ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 43 | E. alaicus | 50 | 21091 | ♂ | 6 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 362 km | 41°21'N 75°59'E | 1983 | – |
| 44 | E. alaicus × E. tancrei hybrid | 53 | 21059 | ♀ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 45 | E. tancrei | 54 | 21060 | ♂ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 46 | E. alaicus × E. tancrei hybrid | 53 | 21061 | ♂ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 47 | E. tancrei | 54 | 21062 | ♂ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 48 | E. alaicus × E. tancrei hybrid | 53 | 21063 | ♀ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 49 | E. tancrei | 54 | 21064 | ♂ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 50 | E. tancrei | 54 | 21065 | ♀ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 51 | E. tancrei | 54 | 21072 | ♂ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 52 | E. tancrei | 54 | 21073 | ♀ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 53 | E. tancrei | 54 | 21074 | ♂ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 54 | E. tancrei | 54 | 21075 | ♂ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 55 | E. tancrei | 54 | 21076 | ♀ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 56 | E. tancrei | 54 | 21077 | ♀ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 57 | E. tancrei | 54 | 21078 | ♀ | 7 | Kyrgyzstan. Highway Bishkek - Chatyr-Kel', 270 km, 4 km after Sary-Bulak settlement | 41°55'N 75°43'E | 1983 | – |
| 58 | E. alaicus | 48 | 25600 | ♂ | 8 | Tajikistan. The right bank of the Kyzyl-Suu River, 4 km to the East from the Achek-Alma settlement, 2160 m above sea level | 39°22.73'N 71°40.68'E | 2010 | – |
| 59 | E. alaicus | 48 | 25605 | ♀ | 8 | Tajikistan. The right bank of the Kyzyl-Suu River, 4 km to the East from the Achek-Alma settlement, 2160 m above sea level | 39°22.73'N 71°40.68'E | 2010 | MG264322 |
| 60 | E. alaicus | 48 | 25610 | ♀ | 8 | Tajikistan. The right bank of the Kyzyl-Suu River, 4 km to the East from the Achek-Alma settlement, 2160 m above sea level | 39°22.73'N 71°40.68'E | 2010 | MG264323 |
| 61 | E. alaicus | 48 | 25611 | ♂ | 8 | Tajikistan. The right bank of the Kyzyl-Suu River, 4 km to the East from the Achek-Alma settlement, 2160 m above sea level | 39°22.73'N 71°40.68'E | 2010 | MG264324 |
| 62 | E. alaicus | 48 | 25612 | ♀ | 8 | Tajikistan. The right bank of the Kyzyl-Suu River, 4 km to the East from the Achek-Alma settlement, 2160 m above sea level | 39°22.73'N 71°40.68'E | 2010 | MG264325 |
| 63 | E. alaicus | 48 | 25622 | ♀ | 8 | Tajikistan. The right bank of the Kyzyl-Suu River, 4 km to the East from the Achek-Alma settlement, 2160 m above sea level | 39°22.73'N 71°40.68'E | 2010 | – |
| 64 | E. alaicus | 50 | 20054 | ♀ | 8 | Tajikistan. The right bank of the Kyzyl-Suu River, 4 km to the East from the Achek-Alma settlement, 2160 m above sea level | 39°22.73'N 71°40.68'E | 1981 | – |
| 65 | E. alaicus | 50–51 | 20053 | ♂ | 8 | Tajikistan. The right bank of the Kyzyl-Suu River, 4 km to the East from the Achek-Alma settlement, 2160 m above sea level | 39°22.73'N 71°40.68'E | 1981 | – |
| 66 | E. alaicus | 50 | 20050 | ♂ | 8 | Tajikistan. The right bank of the Kyzyl-Suu River, 4 km to the East from the Achek-Alma settlement, 2160 m above sea level | 39°22.73'N 71°40.68'E | 1981 | – |
| 67 | E. alaicus | 48 | 25602 | ♀ | 9 | Tajikistan. The left bank of the Kyzyl-Suu River, in front of the Duvana settlement, 2000 m above sea level | 39°20.7'N 71°34.73'E | 2010 | MG264326 |
| 68 | E. alaicus | 48 | 27023 | ♀ | 9' | Tajikistan. The left bank of the Kyzyl-Suu River, in front of the Duvana settlement, 2000 m above sea level | 39°20.588'N 71°34.528'E | 2018 | – |
| 69 | E. alaicus | 48 | 27024 | ♂ | 9' | Tajikistan. The left bank of the Kyzyl-Suu River, in front of the Duvana settlement, 2000 m above sea level | 39°20.588'N 71°34.528'E | 2018 | – |
| 70 | E. alaicus | 48 | 27025 | ♂ | 10 | Tajikistan. The left bank of the Kyzyl-Suu River, close to Dzhailgan settlement | 39°19.277'N 71°32.772'E | 2018 | MK544910 |
| 71 | E. alaicus | 48 | 27026 | ♂ | 10 | Tajikistan. The left bank of the Kyzyl-Suu River, close to Dzhailgan settlement | 39°19.277'N 71°32.772'E | 2018 | MK544911 |
| 72 | E. alaicus | 48 | 27028 | ♀ | 11 | Tajikistan. The left bank of the Kyzyl-Suu River, 3 km to the East from the bridge to Kashat settlement | 39°18.449'N 71°28.480'E | 2018 | MK544913 |
| 73 | E. alaicus | 48 | 27029 | ♀ | 11 | Tajikistan. The left bank of the Kyzyl-Suu River, 3 km to the East from the bridge to Kashat settlement | 39°18.449'N 71°28.480'E | 2018 | MK544914 |
| 74 | E. alaicus | 48 | 27030 | ♀ | 12 | Tajikistan. The left bank of the Muksu River, close to Sary-Tala settlement | 39°14.748'N 71°25.000'E | 2018 | MK544915 |
| 75 | E. alaicus | 48 | 27031 | ♀ | 12 | Tajikistan. The left bank of the Muksu River, close to Sary-Tala settlement | 39°14.748'N 71°25.000'E | 2018 | – |
| 76 | E. alaicus | 48 | 27032 | ♀ | 12 | Tajikistan. The left bank of the Muksu River, close to Sary-Tala settlement | 39°14.748'N 71°25.000'E | 2018 | MK544916 |
| 77 | E. alaicus | 48 | 27033 | ♂ | 12 | Tajikistan. The left bank of the Muksu River, close to Sary-Tala settlement | 39°14.748'N 71°25.000'E | 2018 | MK544917 |
| 78 | E. tancrei | 54 | 27019 | ♂ | 13 | Tajikistan. Pamir-Alay, close to Utol Poyon settlement, the southern bank of the Surkhob River | 39°9.737'N 71°7.374'E | 2018 | MK544906 |
| 79 | E. tancrei | 54 | 27020 | ♀ | 13 | Tajikistan. Pamir-Alay, close to Utol Poyon settlement, the southern bank of the Surkhob River | 39°9.737'N 71°7.374'E | 2018 | MK544907 |
| 80 | E. tancrei | 54 | 27021 | ♂ | 13 | Tajikistan. Pamir-Alay, close to Utol Poyon settlement, the southern bank of the Surkhob River | 39°9.737'N 71°7.374'E | 2018 | MK544908 |
| 81 | E. tancrei | 54 | 27022 | ♀ | 13 | Tajikistan. Pamir-Alay, close to Utol Poyon settlement, the southern bank of the Surkhob River | 39°9.737'N 71°7.374'E | 2018 | MK544909 |
| 82 | E. tancrei | 54 | 27017 | ♂ | 14 | Tajikistan. Pamir-Alay, between settlements Kichikzy – Utol Poyon, the southern bank of the Surkhob River | 39°7.625'N 70°59.762'E | 2018 | MK544904 |
| 83 | E. tancrei | 54 | 27018 | ♀ | 14 | Tajikistan. Pamir-Alay, between settlements Kichikzy – Utol Poyon, the southern bank of the Surkhob River | 39°7.625'N 70°59.762'E | 2018 | MK544905 |
| 84 | E. tancrei | 54 | 27027 | ♂ | 14 | Tajikistan. Pamir-Alay, between settlements Kichikzy – Utol Poyon, the southern bank of the Surkhob River | 39°7.625'N 70°59.762'E | 2018 | MK544912 |
| 85 | E. tancrei | 52 | 24898 | ♂ | 15 | Tajikistan. Pamir-Alay, close to Kichikzy settlement, the southern bank of the Surkhob River | 39°8.23'N 70°57.33'E | 2008 | MK544900 |
| 86 | E. tancrei | 51 | 24899 | ♀ | 15 | Tajikistan. Pamir-Alay, close to Kichikzy settlement, the southern bank of the Surkhob River | 39°8.23'N 70°57.33'E | 2008 | |
| 87 | E. tancrei | 30 | 25601 | ♀ | 16 | Tajikistan. Pamir-Alay, close to the settlement Shilbili, the northern bank of the Surkhob River, 1900 m above sea level | 39°15.37'N, 71°20.59'E | 2010 | MG264327 |
| 88 | E. tancrei | 30 | 25618 | ♀ | 16 | Tajikistan. Pamir-Alay, close to the settlement Shilbili, the northern bank of the Surkhob River, 1900 m above sea level | 39°15.37'N 71°20.59'E | 2010 | MG264328 |
| 89 | E. tancrei | 30 | 25625 | ♂ | 16 | Tajikistan. Pamir-Alay, close to the settlement Shilbili, the northern bank of the Surkhob River, 1900 m above sea level | 39°15.37'N 71°20.59'E | 2010 | MG264329 |
| 90 | E. tancrei | 30 | 25626 | ♀ | 16 | Tajikistan. Pamir-Alay, close to the settlement Shilbili, the northern bank of the Surkhob River, 1900 m above sea level | 39°15.37'N 71°20.59'E | 2010 | MG264330 |
| 91 | E. tancrei | 48 | 24872 | ♀ | 17 | Tajikistan. Pamir-Alay, the right bank of the Surkhob River, close to the airport Garm, 1310 m above sea level | 39°0.28'N 70°17.77'E | 2008 | MG264331 |
| 92 | E. tancrei | 48 | 24873 | ♀ | 17 | Tajikistan. Pamir-Alay, the right bank of the Surkhob River, close to the airport Garm, 1310 m above sea level | 39°0.28'N 70°17.77'E | 2008 | MG264332 |
| 93 | E. tancrei | 48 | 24874 | ♂ | 17 | Tajikistan. Pamir-Alay, the right bank of the Surkhob River, close to the airport Garm, 1310 m above sea level | 39°0.28'N 70°17.77'E | 2008 | MG264333 |
| 94 | E. tancrei | 48 | 24876 | ♂ | 17 | Tajikistan. Pamir-Alay, the right bank of the Surkhob River, close to the airport Garm, 1310 m above sea level | 39°0.28'N 70°17.77'E | 2008 | MG264334 |
| 95 | E. tancrei | 48 | 24914 | ♀ | 17 | Tajikistan. Pamir-Alay, the right bank of the Surkhob River, close to the airport Garm, 1310 m above sea level | 39°0.28'N 70°17.77'E | 2008 | MG264335 |
| 96 | E. tancrei | 48 | 24915 | ♂ | 17 | Tajikistan. Pamir-Alay, the right bank of the Surkhob River, close to the airport Garm, 1310 m above sea level | 39°0.28'N 70°17.77'E | 2008 | MG264336 |
| 97 | E. tancrei | 50 | 24904 | ♀ | 18 | Tajikistan. Pamir-Alay, the left bank of the Surkhob River near the Shulonak, on the way to Voidara settlement, 1300 m above sea level | 38°59.3'N 70°16.1'E | 2008 | MG264337 |
| 98 | E. tancrei | 50 | 24911 | ♂ | 19 | Tajikistan. Pamir-Alay, the left bank of the Surkhob River near the Voydara settlement, 1440 m above sea level | 38°58.9'N 70°14.71'E | 2008 | – |
| 99 | E. tancrei | 50 | 24907 | ♀ | 19 | Tajikistan. Pamir-Alay, the left bank of the Surkhob River near the Voydara settlement, 1440 m above sea level | 38°58.9'N 70°14.71'E | 2008 | MG264338 |
| 100 | E. tancrei | 50 | 24910 | ♂ | 19 | Tajikistan. Pamir-Alay, the left bank of the Surkhob River near the Voydara settlement, 1440 m above sea level | 38°58.9'N 70°14.71'E | 2008 | MG264339 |
| 101 | E. tancrei | 54 | 20769 | ♂ | 20 | Uzbekistan. Close to Sokh settlement, 11 km to the west | 39°58'N 70°58'E | 1983 | – |
| 102 | E. tancrei | 54 | 20770 | ♀ | 20 | Uzbekistan. Close to Sokh settlement, 11 km to the west | 39°58'N 70°58'E | 1983 | – |
| 103 | E. tancrei | 54 | 20772 | ♂ | 20 | Uzbekistan. Close to Sokh settlement, 11 km to the west | 39°58'N 70°58'E | 1983 | – |
| 104 | E. tancrei | 54 | 20773 | ♀ | 20 | Uzbekistan. Close to Sokh settlement, 11 km to the west | 39°58'N 70°58'E | 1983 | – |
| 105 | E. tancrei | 54 | 25159 | ♂ | 21 | Uzbekistan. Tashkent city | 41°20.49'N 70°18.71'E | 2009 | MG264346 |
| 106 | E. tancrei | 54 | 20561 | ♀ | 22 | Kyrgyzstan. The Southern bank of the Issyk-Kel' Lake, 16 km to the South from the Barskaun settlement, Lake Barskaun canyon | 42°00'N 77°37'E | 1982 | – |
| 107 | E. tancrei | 54 | 20562 | ♂ | 22 | Kyrgyzstan. The Southern bank of the Issyk-Kel' Lake, 16 km to the South from the Barskaun settlement, Lake Barskaun canyon | 42°00'N 77°37'E | 1982 | – |
| 108 | E. tancrei | 54 | 24912 | ♂ | 23 | Tajikistan. The northern bank of the Vakhsh River, Miskinobod, 1780 m above sea level | 38°39.78'N 69°33.29'E | 2008 | MG264344 |
| 109 | E. tancrei | 54 | 24913 | ♂ | 24 | Tajikistan. Panchkotan gorge, left bank of the Sorbo River, close to Romit reserve, 1265 m above sea level | 38°45.27'N 69°17.6'E | 2008 | MG264345 |
| 110 | E. tancrei | 50 | 24905 | ♂ | 25 | Tajikistan. The Varzob Valley, near the Khodzha-Obi-Garm settlement, 2000 m above sea level | 38°53.53'N 68°46.52'E | 2008 | MG264340 |
| 111 | E. tancrei | 50 | 24906 | ♂ | 25 | Tajikistan. the Varzob Valley, near the Khodzha-Obi-Garm settlement, 2000 m above sea level | 38°53.53'N 68°46.52'E | 2008 | MG264341 |
| 112 | E. tancrei | 50 | 24916 | ♀ | 25 | Tajikistan. the Varzob Valley, near the Khodzha-Obi-Garm settlement, 2000 m above sea level | 38°53.53'N 68°46.52'E | 2008 | MG264342 |
| 113 | E. tancrei | 50 | 24917 | ♂ | 25 | Tajikistan. the Varzob Valley, near the Khodzha-Obi-Garm settlement, 2000 m above sea level | 38°53.53'N 68°46.52'E | 2008 | MG264343 |
| 114 | E. tancrei | 54 | 27016 | ♂ | 26 | Tajikistan. Khatlon district, close to Sovetabad settlement | 37°28.479'N 68°15.568'E | 2018 | MK544903 |
| 115 | E. tancrei | 54 | 27013 | ♂ | 27 | Tajikistan. Khatlon district, close to Aivadj settlement | 36°58.168'N 68°0.791'E | 2018 | MK544901 |
| 116 | E. tancrei | 54 | 27014 | ♂ | 27 | Tajikistan. Khatlon district, close to Aivadj settlement | 36°58.168'N 68°0.791'E | 2018 | MK544902 |
| 117 | E. talpinus | 54 | 24736 | ♀ | 28 | Russia. Orenburg oblast, Belyaevsky district, about 15 km southeast of the Belyaevka village | 51°14'N 56°38'E | 2005 | MG264347 |
| 118 | E. talpinus | 54 | 26910 | ♂ | 29 | Russia. Samara oblast, Stavropolsky rayon, Samarskaya Luka | 53°9.98'N 49°35.35'E | 2016 | MG264354 |
| 119 | E. talpinus | – | 26491 | ♀ | 30 | Russia. Crimea, Bakhchisaraysky district, 2 km south of the Sevastyanovka village | 44°47.82'N 33°55.95'E | 2013 | MG264359 |
| 120 | E. talpinus | – | 26493 | ♀ | 30 | Russia. Crimea, Bakhchisaraysky district, 2 km south of the Sevastyanovka village | 44°47.82'N 33°55.95'E | 2013 | cytb mitotype is identical to MG264359 |
| 121 | E. talpinus | 54 | 26800 | ♀ | 31 | Russia. Omsk oblast, Tavrichesky district, near the Novouralsky railway station, about 16 km south-east of the Novouralsky village | 54°14.586'N 74°17.66'E | 2014 | MG264351 |
| 122 | E. talpinus | 54 | 26802 | ♀ | 32 | Russia. Novosibirsk oblast, Tatarsky district, near the Novopervomayskoe village and Lagunaka railway station | 55°8.64'N 75°21.94'E | 2014 | MG264352 |
| 123 | E. talpinus | 54 | 26850 | ♂ | 33 | Russia. Omsk oblast, Cherlaksky district, approximately 3.5 km northeast of the Irtysh village | 54°30.59'N 74°25.95'E | 2015 | MG264353 |
We used samples from the Joint collection of wildlife tissues for fundamental, applied and environmental researches of the Koltzov Institute of Developmental Biology RAS, the state registration number AAAA-A16-116120810085-1, which is a part of the Core Centrum of the Koltzov Institute of Developmental Biology RAS, the state registration number 6868145. Tissues and chromosome suspensions were collected during our field trips in 1981–1983, 2008, 2010, 2013, and 2015–2018. For cytb sequencing we also used dried skins of specimens S132130*, S132131*, S132133*, S132135* deposited to the Zoological Museum of Lomonosov Moscow State University (Table
Animals were treated according to established international protocols, as in the Guidelines for Humane Endpoints for Animals Used in Biomedical Research. All the experimental protocols were approved by the Ethics Committees for Animal Research of the Koltzov Institute of Developmental Biology RAS in accordance with the Regulations for Laboratory Practice in the Russian Federation. All efforts were made to minimize animal suffering.
Chromosomes from bone marrow were prepared according to
Images were captured using VideoTesT-FISH 2.0. and VideoTesT-Karyo 3.1. (Imicrotec) or Case Data Manager 6.0 (Applied Spectral Imaging Inc., ASI) software with either ProgRes CCD (Jenoptik) or ASI CCD camera, respectively, mounted on an Axioskop 2 plus (Zeiss) microscope with filter sets for DAPI, FITC, and rhodamine. Hybridization signals were assigned to specific chromosome regions defined by GTG-banding patterns previously captured with the CCD camera. Routine and G-banded plates were captured with a CMOS camera, mounted on an Axioskop 40 (Zeiss) microscope. Images were processed using Paint Shop Pro X2 (Corel).
The suspensions and spreads of spermatocytes of two E. alaicus males (27024, 27025) were made as described by
Total DNA was isolated by phenol-chloroform deproteinisation after treatment of shredded tissues with proteinase K (
Primers, which were used for amplification and sequencing of cytb gene in mole voles of the Ellobius subgenus. Primers Eta_CytbF1, and VOLE14 were used to amplify the full cytb gene with flanked fragments of mtDNA; all other primers correspond to various internal areas of cytb gene, the position of their 5’-end nucleotide from the start of cytb gene is in parentheses.
| Species | Primer designation | Nucleotide sequence of primer (5’–3’) and its localization within the full gene cytb | Citation |
|---|---|---|---|
| E. talpinus | Forward primers | ||
| Eta_CytbF1 | GAAACACCTAATGACAATCATACG |
|
|
| L15095-Ell | (370)-ATAGCCACAGCATTCATA |
|
|
| L15473-Ell | (748)-CTCGGAGACCCAGATAACTAC |
|
|
| Reverse primers | |||
| MVZ04m | (431)-GTGGCCCCTCAAAATGATATTTGTCCTC |
|
|
| CLETH16m | (824)-AGGAAGTACCATTCTGGTTTAAT |
|
|
| VOLE14 | TTTCATTACTGGTTTACAAGAC |
|
|
| E. tancrei, E. alaicus | Forward primers | ||
| Eta_CytbF1 | GAAACACCTAATGACAATCATACG |
|
|
| L15095-Ell | (370)-ATAGCCACAGCATTCATA |
|
|
| Vole23m | (590)-TCCTGTTCCTTCACGAAACAGGTTC |
|
|
| L15473-Elal | (748)-CTTGGAGACCCAGACAATTTC | Our design | |
| Reverse primers | |||
| MVZ04m | (431)-GTGGCCCCTCAAAATGATATTTGTCCTC |
|
|
| CLETH16m | (824)-AGGAAGTACCATTCTGGTTTAAT |
|
|
| VOLE14 | TTTCATTACTGGTTTACAAGAC | Conroy, Cook 1999 | |
A total of 53 samples of the subgenus Ellobius mole voles were used for mitochondrial cytb gene sequencing; all sequences have been deposited in GenBank, accession numbers MG264318–MG264347, MG264351–MG264354, MG264359, and MK544900- MK544917 (http://www.ncbi.nlm.nih.gov/genbank/) are listed in the Table
The main result was a discovery of specific chromosome variability in E. alaicus, with 2n varying from 52 to 48 chromosomes. For mole voles from the Alay Ridge, the Naryn Valley, and the Aksai River Valley (localities # 3, 5, 6, Fig.
G-banded karyotypes of E. alaicus a 2n = 52, 21071, ♂, locality #6 b 2n = 50, 21089, ♂, locality #6 c 2n = 50 20054, ♀, locality #8. The chromosome nomenclature follows
Two heterozygous karyotypes with 2n = 53 due to the presence of different Rb metacentrics were found. In point # 3, we found animals with 2n = 53 and 1 Rb(2.11), which are hybrids of E. alaicus and E. tancrei (Fig.
G-banded karyotypes of heterozygous mole voles a 2n = 53 20778, ♂, locality #3 b 2n = 53, 21059, ♀, locality #7 c 2n = 51, 21070, ♀, locality #6. Scale bar: 10 μm.
The most surprising data we revealed for animals from the Pamir-Alay mountains, Tajikistan, (# 8, Fig.
In 2018 we checked chromosome sets for Alay mole voles from the Kyzyl-Suu River Valley, the Kyzyl-Suu and Muksu Rivers interfluve, and the left bank of the Muksu River (localities # 9–12, Fig.
In total we described seven variants of karyotypes for E. alaicus (Table
Fluorescent in situ hybridization of M. agrestis (MAG) probes on E. alaicus metaphase chromosomes, 2n = 48 (locality #8): a MAG 1 (red) and MAG 17+12 (green), 25610 ♀, locality #8; b MAG 1 (green) and MAG 6 (red), 25610 ♀, locality #8; c MAG 1 (red) and MAG 7+6 (green), 25612 ♀, locality #8; d MAG 4 (green) and MAG 10+11 (red), 25612 ♀, locality #8. Scale bar: 10 μm.
G-banded karyotype of a new form of E. alaicus, 2n = 48, 2 Rb (2.11), 2 Rb (4.9), 2 Rb (3.10), 25610 ♀, locality #8. The chromosome nomenclature follows
A few studies dealt with Ellobius molecular phylogeny before.
Here, for the first time, we demonstrated data on molecular, mitochondrial (cytb) and nuclear (XIST and Rspo1 fragments) specificity of E. alaicus. The cytb variability in the subgenus Ellobius, which we demonstrated here, is comparable and even higher than in Ctenomys, subterranean rodents with numerous species-specific chromosome changes (
Chromosome synapsis in pachytene spermatocytes of E. alaicus, 27024, ♂ (2n = 48, NF = 56), locality #9’. Axial SC elements were identified using anti-SYCP3 antibodies (green), anti-CREST for kinetochores (red). Numbers of SC correspond to chromosome numbers in the karyotype (see Fig.
Originally, E. alaicus was described as a species with specific karyotype structure, including a pair of very large bi-armed chromosomes (
Trees of the subgenus Ellobius inferred from complete mitochondrial cytb gene sequences (1143 bp) of 53 specimens a a tree was got by using the Maximum Likelihood method based on the Tamura-Nei model, bootstrap support is listed above main branches. Only values greater than 70 percent are shown b Bayesian inference tree was made in MrBayes ver. 3.2 (
Primers, which were used for amplification and sequencing of XIST and Rspo1 genes in the mole voles of the Ellobius subgenus.
| Nuclear gene | Primer designation | Nucleotide sequence of primer (5’–3’) | Source |
|---|---|---|---|
| XIST | Xist1-L11841 | GGGGTCTCTGGGAACATTTT | Our design |
| Xist1-R12504 or Xist1-Rint | TGCAATAACTCACAAAACCAAC AAGCAGGTAAGTATCCACAGC |
Our design | |
| Rspo1 | Primers used for first amplification | ||
| Rspo1F-Ell | CACTGTACACTTCCGGGTCTCTTT | Our design | |
| Rspo1R-Ell | AGAAGTCAACGGCTGCCTCAAGTG | Our design | |
| Primers used for second PCR with a PRISM®BigDye TM Terminator v. 3.1 kit | |||
| Rspo1-5intF-Ell | CAGGCACGCACACTAGGTTGTAA | Our design | |
| Rspo1-1intR-Ell | GTCTAGACTCCCAACACCTG | Our design | |
Earlier (
Therefore, characteristic nucleotide substitutions in mitochondrial and nuclear genes, distinct Rbs variability and independent origin of typical for E. alaicus translocation Rb(2.11) support the species status of the Alay mole vole notwithstanding the closeness to E. tancrei.
The discovery of different heterozygous animals with 2n = 53 and two different Rb translocations raised the question of natural hybridization and mechanisms of genome stability. Animals that carried 1 Rb(2.11) with a high probability were hybrids of E. alaicus, 2n = 52 and E. tancrei, 2n = 54. For the second variant, 2n = 53 and 1 Rb(1.3), two scenarios are possible. The first is the existence of an unknown form (or species) with 2n = 52, 2 Rb(1.3), which hybridized with E. tancrei, 2n = 52, so hybrids of the first generation or backcrosses had 2n = 53, 1 Rb(1.3). Another possibility is that they were remote hybrids of E. alaicus with 2n = 50, 2 Rb(2.11), 2 Rb(1.3) (as animals from the Lake Chatyr-Kel’ vicinities, #4 or Naryn district, #6) and E. tancrei, 2n = 54. In that case, hybrids might have lost the Rb(2.11) in numerous generations under meiotic drive (
As we mentioned previously (
Molecular phylogenetic analysis of three Ellobius species based on variability of XIST and Rspo1 genes fragments (1652 bp in total) and constructed by using the Maximum Likelihood method and the Jukes-Cantor model. Bootstrap support is listed for main branches. Only values over 70 percent are shown.
Despite a complex relief of the region, the geographical barriers are not as strong as genomic ones. We revealed no signs of hybridization in neighbor populations of E. alaicus and E. tancrei yet, i.e. between E. alaicus (2n = 48, locality #8, Fig.
The study of E. alaicus demonstrates that the difficulty of species delimitation due to lack of morphological differences might be resolved by using chromosomal and molecular markers.
We assumed, that the independent emergence of Robertsonian translocation Rb(2.11) was crucial for the divergence of ancestors of E. alaicus and E. tancrei, which both developed specific karyotypic variability, more extensive in E. tancrei (2n = 54-30) but distinct due to non-homological (except Rb(2.11)) translocations in E. alaicus (2n = 52–48). Notwithstanding, the closeness of species, which was demonstrated here by studying mitochondrial DNA (cytb) and fragments of two nuclear genes, determines the possibility of sporadic hybridization at the zones of species contacts. Using different cytogenetic methods, G-banding and chromosome painting, along with by cytb, XIST, and Rspo1 genes sequencing allowed us to expand the range of E. alaicus from the terra typica, the Alay Valley (South Kyrgyzstan) up to the Ferghana Ridge and the Naryn Basin, Tien Shan at the north-east and to the Pamir-Alay Mountains (Tajikistan) at the west.
We are sincerely grateful to our colleagues for organizing expeditions and providing material, and, especially, V.S. Lebedev, curator of the myomorph rodents collection, Zoological Museum of Moscow State University; I. Pavlinov, A. Zykov, A. Esipov, E. Bykova, S. Ivnitsky, and E. Elina. N. Mugue and D. Schepetov are particularly thanked for consultations and DNA sequencing. This study was supported in part by the Russian Foundation for Basic Researches N 17-04-00618, N 17-00-00146, IDB RAS Government basic research program N 0108-2019-0007, IMCB SB RAS Government basic research program N 0310-2019-0002, and VIGG RAS State Assignment Contract N 0112-2019-0002.