Research Article |
|
Corresponding author: Danon Clemes Cardoso ( danonclemes@gmail.com ) Academic editor: Vladimir Gokhman
© 2020 Ricardo Micolino, Maykon Passos Cristiano, Danon Clemes Cardoso.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Micolino R, Cristiano MP, Cardoso DC (2020) Karyotype and putative chromosomal inversion suggested by integration of cytogenetic and molecular data of the fungus-farming ant Mycetomoellerius iheringi Emery, 1888. Comparative Cytogenetics 14(2): 197-210. https://doi.org/10.3897/CompCytogen.v14i2.49846
|
Comparative cytogenetic analyses are being increasingly used to collect information on species evolution, for example, diversification of closely related lineages and identification of morphologically indistinguishable species or lineages. Here, we have described the karyotype of the fungus-farming ant Mycetomoellerius iheringi Emery, 1888 and investigated its evolutionary relationships on the basis of molecular and cytogenetic data. The M. iheringi karyotype consists of 2n = 20 chromosomes (2K = 18M + 2SM). We also demonstrated that this species has the classical insect TTAGG telomere organization. Phylogenetic reconstruction showed that M. iheringi is phylogenetically closer to M. cirratus Mayhé-Nunes & Brandão, 2005 and M. kempfi Fowler, 1982. We compared M. iheringi with other congeneric species such as M. holmgreni Wheeler, 1925 and inferred that M. iheringi probably underwent a major pericentric inversion in one of its largest chromosomes, making it submetacentric. We discussed our results in the light of the phylogenetic relationships and chromosomal evolution.
chromosomal evolution, FISH, fungus growing, karyomorphometry, TTAGG, Trachymyrmex
Fungus-farming ants (Formicidae: Myrmicinae: Attini) are exclusive to the New World and occur mainly in the Neotropical region, with some species found in the Nearctic region (
Cytogenetics encompasses the study of chromosomes that may have direct implications on species evolution, such as the identification of cryptic species and diversification of closely related lineages (
Former “Trachymyrmex” species with their described karyotypes. 2n: diploid chromosome number; (n): haploid chromosome number; 2K: karyotype formula; Locality: sampling site; M: metacentric chromosomes; SM: submetacentric chromosomes.
| Species | 2n (n) | 2K | Locality | References |
|---|---|---|---|---|
| Mycetomoellerius fuscus* | 18 (9) | 16M + 2SM | Minas Gerais State, Brazil |
|
| Mycetomoellerius holmgreni | 20 (10) | 20M | Minas Gerais State, Brazil |
|
| Mycetomoellerius iheringi | 20 (10) | 18M + 2SM | Santa Catarina State, Brazil | Present study |
| Mycetomoellerius relictus | 20 (10) | 20M | Minas Gerais State, Brazil |
|
| Trachymyrmex septentrionalis | 20 (10) | 20M | Barro Colorado Island, Panama |
|
| “Trachymyrmex” sp. 1 | 12 (6) | 12M | Barro Colorado Island, Panama |
|
| “Trachymyrmex” sp. 2 | 18 (9) | 18M | Barro Colorado Island, Panama |
|
| “Trachymyrmex” sp. 3 | 22 (11) | 18M + 4SM | Minas Gerais State, Brazil |
|
Mycetomoellerius iheringi Emery, 1888, the type species of the genus, is a species endemic to South America, and it occurs mainly in the southern regions. The exclusive characteristic of M. iheringi is the finely striated discal area of the mandibles, which sets it apart from the congeneric species Mycetomoellerius kempfi Fowler, 1982 (
Here, we have described the M. iheringi karyotype on the basis of karyomorphometric analysis and fluorescence in situ hybridization (FISH) with a telomeric probe. In addition, we identified the phylogenetic position of M. iheringi and examined its relationship with other species of the genus. We have discussed our results in the light of chromosomal evolution among fungus-farming ants.
Colonies of M. iheringi were collected from the Restinga environment of the Brazilian Atlantic coast at Joaquina Beach, Florianópolis, Santa Catarina State, Brazil (27°37'44"S; 48°26'52"W). A total of five distantly spaced colonies were sampled. Such colonies were maintained in vivo at the Laboratório de Genética Evolutiva e de Populações, Universidade Federal de Ouro Preto, Brazil, according to the protocol established by
Metaphase chromosomes from the brain ganglia of pre-pupal larvae were obtained using the method of
FISH experiments were performed as previously described by
We extracted the DNA from M. iheringi ant workers, according to the standard CTAB/chloroform technique (
The gene fragments were aligned and concatenated using MEGA7 software (
Primers used for sequencing four nuclear (EF1α-F1, EF1α-F2, Wg and LW Rh) and one mitochondrial (COI) gene fragments in the fungus-farming ant Mycetomoellerius iheringi.
| Gene region | Primer | Sequence 5' to 3' | Source |
|---|---|---|---|
| EF1α-F1 | 1424F | GCGCCKGCGGCTCTCACCACCGAGG | |
| 1829R | GGAAGGCCTCGACGCACATMGG | ||
| EF1α-F2 | 557F | GAACGTGAACGTGGTATYACSAT | |
| 1118R | TTACCTGAAGGGGAAGACGRAG | ||
| LW Rh | LR143F | GACAAAGTKCCACCRGARATGCT | |
| LR639ER | YTTACCGRTTCCATCCRAACA | ||
| Wg | wg578F | TGCACNGTGAARACYTGCTGGATGCG | |
| wg1032R | ACYTCGCAGCACCARTGGAA | ||
| COI | LCO1490 | GGTCAACAAATCATAAAGATATTGG | |
| HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA |
The karyotype of M. iheringi has 2n = 20 chromosomes (Fig.
Mitotic metaphase of Mycetomoellerius iheringi with 2n = 20 chromosomes and its karyotypic morphology. M: metacentric chromosomes; SM: submetacentric chromosomes. Scale bar: 5 μm.
DAPI-stained Mycetomoellerius iheringi chromosomal metaphases a FISH mapping of the TTAGG(6) telomeric motif on haploid metaphase b chromosomes uniformly stained with DAPI fluorochrome, except for the centromeric region. Scale bar: 5 μm.
Karyomorphometric analysis of the chromosomes of Mycetomoellerius iheringi. TL: total length; L: long arm length; S: short arm length; RL: relative length; r: arm ratio (= L/S); ∑: total average length of all chromosomes or Karyotype lenght (KL).
| Chromosome | TL | L | S | RL | r | Classification |
| 1 | 5.77±0.91 | 3.03±0.48 | 2.74±0.43 | 6.97±0.34 | 1.1±0.05 | Metacentric |
| 2 | 5.46±0.75 | 2.86±0.46 | 2.6±0.32 | 6.61±0.24 | 1.1±0.08 | Metacentric |
| 3 | 5.09±0.66 | 3.02±0.41 | 2.08±0.27 | 6.17±0.29 | 1.46±0.09 | Metacentric |
| 4 | 4.71±0.53 | 2.67±0.29 | 2.04±0.28 | 5.72±0.34 | 1.32±0.12 | Metacentric |
| 5 | 4.38±0.49 | 2.38±0.29 | 1.99±0.29 | 5.31±0.2 | 1.21±0.18 | Metacentric |
| 6 | 4.2±0.46 | 2.3±0.23 | 1.91±0.27 | 5.1±0.15 | 1.22±0.14 | Metacentric |
| 7 | 4.07±0.46 | 2.24±0.2 | 1.83±0.33 | 4.94±0.16 | 1.26±0.21 | Metacentric |
| 8 | 4.01±0.44 | 2.3±0.26 | 1.72±0.26 | 4.87±0.16 | 1.32±0.19 | Metacentric |
| 9 | 3.89±0.43 | 2.19±0.3 | 1.7±0.18 | 4.72±0.11 | 1.31±0.14 | Metacentric |
| 10 | 3.83±0.45 | 2.16±0.3 | 1.67±0.17 | 4.65±0.06 | 1.3±0.11 | Metacentric |
| 11 | 3.78±0.43 | 2.15±0.28 | 1.63±0.2 | 4.59±0.1 | 1.32±0.15 | Metacentric |
| 12 | 3.73±0.41 | 2.07±0.3 | 1.66±0.15 | 4.53±0.15 | 1.25±0.15 | Metacentric |
| 13 | 3.7±0.39 | 2.03±0.26 | 1.67±0.19 | 4.5±0.14 | 1.22±0.14 | Metacentric |
| 14 | 3.66±0.4 | 2.08±0.24 | 1.58±0.2 | 4.44±0.13 | 1.33±0.14 | Metacentric |
| 15 | 3.58±0.35 | 2.01±0.28 | 1.57±0.13 | 4.35±0.13 | 1.29±0.17 | Metacentric |
| 16 | 3.54±0.38 | 2.01±0.26 | 1.54±0.17 | 4.3±0.12 | 1.32±0.16 | Metacentric |
| 17 | 3.51±0.4 | 2.04±0.19 | 1.47±0.25 | 4.26±0.13 | 1.41±0.16 | Metacentric |
| 18 | 3.37±0.4 | 1.94±0.29 | 1.43±0.12 | 4.09±0.11 | 1.36±0.13 | Metacentric |
| 19 | 4.29±1.1 | 2.74±0.68 | 1.56±0.42 | 5.15±0.72 | 1.77±0.06 | Submetacentric |
| 20 | 3.94±0.59 | 2.51±0.37 | 1.43±0.22 | 4.76±0.25 | 1.76±0.03 | Submetacentric |
| ∑ | 82.51±0.52 |
The maximum likelihood phylogeny showed M. iheringi as the sister species of a lineage defined as Mycetomoellerius nr cirratus (see
Here, we have provided the karyotypic description of the fungus-farming ant Mycetomoellerius iheringi, which has 2n = 20 chromosomes; we presented its phylogenetic position in the clade of the “Iheringi group”. Considering the cytogenetic data available from fungus-farming ants, we observed a numerical constancy among the karyotypes of the lineages that diverged most recently (i.e., leafcutter ants of the genera Atta and Acromyrmex), suggesting this karyotypic characteristic is shared by the relatively recent lineages. Trachymyrmex septentrionalis, a sister clade of leafcutter ants, has 2n = 20 metacentric chromosomes, equal to those of two Mycetomoellerius species, M. holmgreni and M. relictus Borgmeier, 1934 (see Table
In the new taxonomic status, Mycetomoellerius is composed of about 30 described species (
The application of classical and molecular cytogenetic techniques, such as chromosomal banding and FISH mapping, has increasingly contributed to comparative evolutionary studies. Because of new ant cytogenetic data, valuable information is being collected and correlated to their evolution and exceptional chromosomal diversity. For instance, fusion and fission rearrangements have been proposed to play a crucial role in the diversification of the fungus-farming ants of the genus Mycetophylax Emery, 1913 (
The rich karyotypic diversity of ants deserves special attention. Inversion polymorphisms, for example, have been reported in many ant species. For example, intrapopulational polymorphism has been detected in the Iridomyrmex gracilis Lowne, 1865 complex. Such populations with the same chromosome number but distinct karyotype structures have led authors to propose that a pericentric inversion occurred in a metacentric chromosome, making it acrocentric (n = 6M + 1SM + 1A to n = 5M + 1SM + 2A) (
Another interesting finding was reported in Mycetomoellerius fuscus Emery, 1894 (current junior synonym of M. urichii Forel, 1893, see
Our karyomorphometric approach was used primarily to reveal the chromosomal morphology of M. iheringi. Besides, future karyomorphometric comparisons among populations or even closely related lineages may serve as a basis for a possible delimitation of incipient lineages. For example, populations of M. holmgreni distributed on a North/South continuum of its distribution area diverged significantly in the length of their chromosomes, and the results were supported by flow cytometry analyses of the genome size (
Finally, we used a FISH probe of the highly conserved TTAGG telomeric sequence in most insects (reviewed by
We are grateful to many people who made this work possible. We thank all our colleagues at the Lab and Research Group of Genetics and Evolution of Ants (GEF-UFOP) for their help with the data. We are also grateful for the financial support of the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) – MPC fellowship 309579/2018-0, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Fundação Araucária de Apoio ao Desenvolvimento Científico e Tecnológico do Estado do Paraná, and Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG). The sample collection was authorized by the “Instituto Chico Mendes de Conservação da Biodiversidade” – ICMBio (Special permit number 60019).