Research Article |
|
Corresponding author: Nazar A. Shapoval ( nazaret@bk.ru ) Academic editor: Snejana Grozeva
© 2015 Nazar A. Shapoval, Vladimir A. Lukhtanov.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Shapoval NA, Lukhtanov VA (2015) Intragenomic variations of multicopy ITS2 marker in Agrodiaetus blue butterflies (Lepidoptera, Lycaenidae). Comparative Cytogenetics 9(4): 483-497. https://doi.org/10.3897/CompCytogen.v9i4.5429
|
The eukaryotic ribosomal DNA cluster consists of multiple copies of three genes, 18S, 5. 8S and 28S rRNAs, separated by multiple copies of two internal transcribed spacers, ITS1 and ITS2. It is an important, frequently used marker in both molecular cytogenetic and molecular phylogenetic studies. Despite this, little is known about intragenomic variations within the copies of eukaryotic ribosomal DNA genes and spacers. Here we present data on intraindividual variations of ITS2 spacer in three species of Agrodiaetus Hübner, 1822 blue butterflies revealed by cloning technique. We demonstrate that a distinctly different intragenomic ITS2 pattern exists for every individual analysed. ITS2 sequences of these species show significant intragenomic variation (up to 3.68% divergence), setting them apart from each other on inferred phylogenetic tree. This variation is enough to obscure phylogenetic relationships at the species level.
Agrodiaetus , Lycaenidae , Polyommatus , ITS2 , ribosomal DNA, intraindividual variability, cloning
The eukaryotic ribosomal DNA (rDNA) cluster consists of three genes, 18S, 5. 8S and 28S rRNAs, separated by two internal transcribed spacers, ITS1 and ITS2. This array forms a transcription unit, which is are typically represented in a genome by several hundred tandemly repeated copies (
Ribosomal RNA genes have been widely used in taxonomy, biogeographic, phylogenetic analyses, and molecular cytogenetic studies (
Accordingly, rDNA can be excellent source of cytogenetic markers for comparative genomic studies, evolutionary studies as well as the genetic identification of species (
At the nucleotide sequence level coding regions and spacers can reveal phylogenetic relationships ranging from the level of major phyla of living organisms to the population level, because they differ widely in their rate of evolution (
Unlike highly conserved rRNA genes, non-coding fast evolving transcribed spacers have high level of interspecific variability. Therefore, the internal transcribed spacers are considered to be useful phylogenetic markers, specifically for low-level phylogenetic analyses. ITS1 and ITS2 have been used extensively in phylogenetic reconstruction of closely related species and cryptic species complexes (
During PCR all variants of ITS sequences presented in genome are amplified, therefore, direct sequencing could lead to inaccurate or erroneous phylogenetic reconstructions. Accordingly identifying and examination levels of intragenomic and intraspecific variation among ITS sequences are of real importance.
Agrodiaetus is a species-rich subgenus within the Palearctic genus Polyommatus (
This paper addresses a more detailed analysis of intraindividual variability of ITS2 region in three Polyommatus (Agrodiaetus) species: P. (A.) peilei Bethune-Baker, 1921, P. (A.) karindus (Reiley, 1921) and P. (A.) morgani (Le Cerf, 1909). These three species are closely related to each other (
Butterflies (only males) were collected in NW Iran (Zagros mt., Kordestan provience) in 2007–2014. Bodies were placed in 2 ml plastic vials with 100% ethanol for DNA analysis. Wings were stored in glassine envelopes for morphological study. All samples are stored at Zoological Institute, St Petersburg, Russia.
ITS2 region was amplified using the primer pair: ITS-3 and ITS-4 (
ILYC2F 5`- GAGAAACATCCAGGACCACT - 3` and
ILYC2RB 5` - CTGATCTGAGGCCA ACG - 3`.
The PCR amplifications were performed either in 50 µl reaction volume containing ca. 10–20 ng genomic DNA and 0.5 mM of each primer, using 26 PCR Master Mix (Fermentas, Lithuania). The temperature profile was as follows: initial denaturation at 94 °C for 1 min, followed by 30 cycles of denaturation at 94 °C for 45 s, annealing at 50 °C for 45 s, and extension at 72 °C for 1 min with a final extension at 72 °C for 10 min.
Amplified fragments were purified using GeneJET Gel Extraction Kit (Fermentas, Lithuania). Purification was carried out according to the manufacturer’s protocol. The success of PCR amplification and purification was evaluated by electrophoresis of the products in 1% agarose gel. Purified PCR product was used for direct sequencing or subsequent cloning.
ITS2 PCR products were cloned into blunt-end cloning vector pJET1.2 (Fermentas, Lithuania) according to the manufacturer’s protocol for 10 minutes at room temperature. The pJet1.2 plasmid selects successful ligations through the disruption of an otherwise lethal gene, eco47IR, which enables positive selection of the recombinants. Before ligation, a 3’-A overhang were removed from the PCR products by treating the PCR product with a proofreading DNA polymerase. For transformation 5 µl of the ligation mixture reaction were added to 50 µl of chemo-competent E. coli DH101B cells an incubated for 10 min. on ice. After incubation transformation mixture were pipetted onto pre-warmed LB Anp IPTG agar plate and spread by using inoculation loop. Agar plates with competent E. coli were incubated overnight at 37 °C.
For each cloning, more than 500 clones were obtained. To check if the cloning procedures were successful, PCR with ITS2-speciffic primers were conducted for 20 colonies per cloning reaction. GeneJET Plasmid Miniprep Kit (Fermentas, Lithuania) was used for preparation of plasmid DNA from recombinant E. coli culture. A single colony from a freshly streaked selective plate were picked to inoculate 1–5 mL of LB medium supplemented with ampicillin and incubated for 12–16 hours at 37 °C while shaking at 200–250 rpm. The bacterial culture was harvested by centrifugation at 8000 rpm (6800 × g) in a microcentrifuge for 2 min at room temperature. The supernatant was decanted and all remaining medium was removed. The pelleted cells were resuspended and subjected to SDS/alkaline lysis to liberate the plasmid DNA. The resulting lysate was neutralized to create appropriate conditions for binding of plasmid DNA on the silica membrane in the spin column. Cell debris and SDS precipitate were pelleted by centrifugation, and the plasmid DNA were washed to remove contaminants and eluted.
Sequencing was carried out using 3500xL analyzer (Applied Biosystems). Not less than 300 ng of plasmid DNA template was used for sequencing procedure. Cloned fragments were analyzed edited and aligned in Bioedit Software.
A Bayesian approach for estimating phylogeny was used. Bayesian trees were inferred using partitioned models: GTR for nucleotide substitutions and standard model for indels as implemented in MRBAYES v. 3.2 (
Sequenced region contained 3` end of 5.8S gene, ITS2, and the 5` end of the 28S gene. Direct sequencing of amplicons of 30 individuals (10 individuals per each species) displayed intra-individual heterogeneities in all specimens analyzed. There are two kinds of heterogeneities: single nucleotide substitutions and mono, bi- and multi-nucleotide insertions/deletions. The presence of heterogeneities was indicated by double peaks in substitution positions, and by a series of mixed peaks in case of indel events, both positioned after a sequence of good quality. The examples of heterogeneities revealed by direct sequencing are displayed in Figure
Examples of results from direct sequencing of ITS2. a Example of polymorphism caused by an indel (black arrow indicate the beginning position of an indel) b Example of single nucleotide substitutions (indicated by black arrows).
To elucidate the visible heterogeneity, the amplicons for 2 specimens of P. (A.) peilei, 2 specimens of P. (A.) karindus and one specimen of P. (A.) morgani were cloned and 10 clones per specimen were sequenced. The summary of the heterogeneities in the ITS region displayed by the clones is depicted in Table
| Specimen | Clone number | Position | |||||||||||||||||||||||||||||||||||||||||
| 128 | 130 | 131 | 171 | 172 | 173 | 235 | 316 | 326 | 329 | 330 | 331 | 332 | 333 | 334 | 335 | 336 | 337 | 338 | 339 | 340 | 341 | 342 | 343 | 344 | 345 | 346 | 356 | 400 | 414 | 465 | |||||||||||||
| W136 P. (A.) peilei | #01 | T | G | - | C | G | C | A | A | T | T | T | T | T | T | T | T | - | - | C | G | T | T | T | T | T | - | C | G | G | G | C | |||||||||||
| W136 P. (A.) peilei | #02 | T | G | - | C | G | C | A | A | T | T | T | T | T | T | T | T | - | - | C | G | T | T | T | T | T | - | C | G | G | G | T | |||||||||||
| W136 P. (A.) peilei | #03 | T | A | A | C | A | C | G | G | C | T | T | T | T | T | T | T | T | T | T | G | T | T | T | T | T | - | C | A | G | A | C | |||||||||||
| W136 P. (A.) peilei | #04 | T | G | - | C | G | C | A | A | T | T | T | T | T | T | T | T | - | - | T | G | T | T | T | T | T | - | C | G | G | G | C | |||||||||||
| W136 P. (A.) peilei | #05 | T | A | A | C | A | C | G | G | C | T | T | T | T | T | T | T | T | T | T | G | T | T | T | T | T | T | - | A | G | G | C | |||||||||||
| W136 P. (A.) peilei | #06 | T | G | - | C | G | C | A | A | T | T | T | T | T | T | - | - | - | - | T | G | T | T | T | T | T | - | C | G | G | G | C | |||||||||||
| W136 P. (A.) peilei | #07 | T | G | - | C | G | C | A | A | C | T | T | T | T | T | T | T | T | T | T | G | T | T | T | T | T | T | - | A | G | G | C | |||||||||||
| W136 P. (A.) peilei | #08 | A | A | - | - | - | - | A | A | T | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | A | A | G | C | |||||||||||
| W136 P. (A.) peilei | #09 | T | A | A | C | A | C | G | G | C | T | T | T | T | T | T | T | T | T | T | G | T | T | T | T | T | T | - | A | G | G | C | |||||||||||
| W136 P. (A.) peilei | #10 | T | G | - | C | G | C | A | A | T | T | T | T | T | T | T | T | - | - | T | G | T | T | T | T | T | - | C | G | G | G | C | |||||||||||
| 14 | 41 | 128 | 131 | 169 | 170 | 171 | 176 | 184 | 185 | 186 | 187 | 188 | 189 | 190 | 191 | 192 | 193 | 194 | 195 | 196 | 197 | 198 | 199 | 200 | 235 | 236 | 326 | 336 | 337 | 338 | 345 | 346 | 356 | ||||||||||
| W202 P. (A.) peilei | #01 | T | C | T | - | A | C | C | T | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | A | - | T | T | T | - | T | - | A | ||||||||
| W202 P. (A.) peilei | #02 | T | T | T | A | A | C | C | T | T | C | G | C | G | T | C | G | G | C | G | A | C | G | T | G | C | G | G | C | T | T | T | T | - | A | ||||||||
| W202 P. (A.) peilei | #03 | T | T | G | - | - | - | - | T | T | C | G | C | G | T | C | G | G | C | G | A | C | G | T | G | C | G | G | T | T | T | C | - | C | G | ||||||||
| W202 P. (A.) peilei | #04 | T | T | T | - | A | C | C | C | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | A | - | T | T | - | C | - | C | G | ||||||||
| W202 P. (A.) peilei | #05 | C | C | T | A | A | C | C | T | T | C | G | C | G | T | C | G | G | C | G | A | C | G | T | G | C | G | G | C | T | T | - | T | - | A | ||||||||
| W202 P. (A.) peilei | #06 | T | T | T | A | A | C | C | T | T | C | G | C | G | T | C | G | G | C | G | A | C | G | T | G | C | G | G | C | T | T | T | T | - | A | ||||||||
| W202 P. (A.) peilei | #07 | T | T | T | A | A | C | C | T | T | C | G | C | G | T | C | G | G | C | G | A | C | G | T | G | C | G | G | C | T | T | T | T | - | A | ||||||||
| W202 P. (A.) peilei | #08 | T | C | T | - | A | C | C | T | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | A | - | T | - | - | C | - | C | G | ||||||||
| W202 P. (A.) peilei | #09 | T | T | T | A | A | C | C | T | T | C | G | C | G | T | C | G | G | C | G | A | C | G | T | G | C | G | G | T | T | T | T | T | - | A | ||||||||
| W202 P. (A.) peilei | #10 | T | C | T | - | A | C | C | T | T | C | G | C | G | T | C | G | G | C | G | A | C | G | T | G | C | A | - | T | T | T | C | - | C | G | ||||||||
| 20 | 150 | 154 | 155 | 166 | 239 | 340 | 341 | 342 | |||||||||||||||||||||||||||||||||||
| V145 P. (A.) karindus | #01 | A | C | - | - | T | T | T | T | - | |||||||||||||||||||||||||||||||||
| V145 P. (A.) karindus | #02 | A | C | - | - | T | T | T | - | - | |||||||||||||||||||||||||||||||||
| V145 P. (A.) karindus | #03 | A | T | C | G | T | T | - | - | - | |||||||||||||||||||||||||||||||||
| V145 P. (A.) karindus | #04 | A | T | C | G | T | T | - | - | - | |||||||||||||||||||||||||||||||||
| V145 P. (A.) karindus | #05 | A | T | C | G | T | T | T | - | - | |||||||||||||||||||||||||||||||||
| V145 P. (A.) karindus | #06 | A | C | - | - | T | C | - | - | - | |||||||||||||||||||||||||||||||||
| V145 P. (A.) karindus | #07 | A | T | C | G | C | T | T | T | T | |||||||||||||||||||||||||||||||||
| V145 P. (A.) karindus | #08 | A | C | - | - | T | T | T | - | - | |||||||||||||||||||||||||||||||||
| V145 P. (A.) karindus | #09 | A | C | - | - | T | T | - | - | - | |||||||||||||||||||||||||||||||||
| V145 P. (A.) karindus | #10 | G | C | - | - | T | T | - | - | - | |||||||||||||||||||||||||||||||||
| 27 | 84 | 128 | 136 | 169 | 170 | 171 | 331 | 335 | 336 | 337 | 337 | 338 | 339 | 340 | 346 | 351 | 352 | 353 | 354 | ||||||||||||||||||||||||
| Z04 P. (A.) karindus | #01 | C | G | T | T | C | C | A | C | T | T | T | T | T | T | T | C | - | A | A | A | ||||||||||||||||||||||
| Z04 P. (A.) karindus | #02 | C | G | T | T | C | C | A | T | T | T | T | T | T | T | T | C | - | A | A | A | ||||||||||||||||||||||
| Z04 P. (A.) karindus | #03 | C | G | T | T | C | C | A | T | T | T | T | T | T | T | T | C | - | A | A | A | ||||||||||||||||||||||
| Z04 P. (A.) karindus | #04 | C | G | T | T | C | C | A | T | T | T | T | T | T | T | T | C | - | A | A | A | ||||||||||||||||||||||
| Z04 P. (A.) karindus | #05 | T | G | T | - | C | C | A | T | T | T | T | T | T | T | - | C | A | A | A | A | ||||||||||||||||||||||
| Z04 P. (A.) karindus | #06 | T | G | T | - | C | C | A | T | T | T | T | T | T | T | - | C | A | A | A | A | ||||||||||||||||||||||
| Z04 P. (A.) karindus | #07 | T | A | T | - | C | C | A | T | T | T | T | T | T | T | - | C | A | A | A | A | ||||||||||||||||||||||
| Z04 P. (A.) karindus | #08 | C | G | T | T | C | C | A | T | T | T | T | T | T | T | - | C | - | A | A | A | ||||||||||||||||||||||
| Z04 P. (A.) karindus | #09 | C | G | T | T | C | C | A | T | T | T | T | T | T | T | - | C | - | A | A | A | ||||||||||||||||||||||
| Z04 P. (A.) karindus | #10 | T | G | G | - | - | - | - | C | - | - | - | - | - | - | - | - | - | - | - | - | ||||||||||||||||||||||
| 7 | 38 | 43 | 79 | 127 | 128 | 148 | 171 | 172 | 173 | 229 | 301 | 318 | 319 | 320 | 321 | 322 | 323 | 324 | 325 | 326 | 327 | 328 | 329 | 330 | 331 | 332 | 333 | 334 | 347 | 348 | 349 | 350 | 352 | 353 | 354 | 355 | 357 | 358 | 391 | 400 | 472 | ||
| W127 P. (A.) morgani | #01 | A | A | C | - | C | G | T | - | - | - | T | C | A | C | A | C | G | T | T | T | T | T | T | T | T | - | - | - | - | A | A | C | G | - | - | - | A | A | A | A | G | G |
| W127 P. (A.) morgani | #02 | A | A | C | - | C | G | T | - | - | - | C | C | A | C | A | C | G | T | T | T | T | T | T | T | T | T | T | T | T | A | A | C | G | - | - | - | A | A | T | A | G | G |
| W127 P. (A.) morgani | #03 | A | A | C | - | A | T | C | C | G | C | T | G | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | G | C | A | A | G | A | G | G | T |
| W127 P. (A.) morgani | #04 | A | G | C | G | A | T | T | C | G | C | T | G | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | G | C | A | A | G | A | G | G | G |
| W127 P. (A.) morgani | #05 | G | G | C | G | C | G | T | - | - | - | T | C | A | C | A | C | G | T | T | C | T | T | T | T | T | T | T | T | - | A | A | C | G | - | - | - | A | A | A | A | G | G |
| W127 P. (A.) morgani | #06 | A | A | C | - | C | G | T | - | - | - | T | C | A | C | A | C | G | T | T | T | T | T | T | T | T | T | T | - | - | A | A | C | G | - | - | - | A | A | A | A | A | G |
| W127 P. (A.) morgani | #07 | A | A | C | - | C | G | T | C | G | C | T | G | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | G | C | A | A | G | A | G | G | G |
| W127 P. (A.) morgani | #08 | A | A | C | G | A | T | T | C | G | C | T | C | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | G | C | A | - | A | A | A | G | T |
| W127 P. (A.) morgani | #09 | A | A | T | G | A | T | T | C | G | C | T | G | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | G | C | A | A | G | A | G | G | G |
| W127 P. (A.) morgani | #10 | A | A | C | - | C | G | T | - | - | - | T | G | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | G | C | A | A | G | A | G | G | G |
| P. (A.) peilei | W136_#01 | W136_#02 | W136_#03 | W136_#04 | W136_#05 | W136_#06 | W136_#07 | W136_#08 | W136_#09 | W136_#10 |
| W136_#01 | - | |||||||||
| W136_#02 | 0.0019 | - | ||||||||
| W136_#03 | 0.0196 | 0.0216 | - | |||||||
| W136_#04 | 0.0019 | 0.0039 | 0.0177 | - | ||||||
| W136_#05 | 0.0216 | 0.0236 | 0.0058 | 0.0196 | - | |||||
| W136_#06 | 0.0058 | 0.0078 | 0.0176 | 0.0039 | 0.0196 | - | ||||
| W136_#07 | 0.0117 | 0.0137 | 0.0157 | 0.0098 | 0.0098 | 0.0098 | - | |||
| W136_#08 | 0.0182 | 0.0202 | 0.0223 | 0.0162 | 0.0202 | 0.0162 | 0.0141 | - | ||
| W136_#09 | 0.0216 | 0.0236 | 0.0058 | 0.0196 | 0 | 0.0196 | 0.0098 | 0.0202 | - | |
| W136_#10 | 0.0019 | 0.0039 | 0.0177 | 0 | 0.0196 | 0.0039 | 0.0098 | 0.0162 | 0.0196 | - |
| Average | 0,0134 | |||||||||
| P. (A.) peilei | W202_#01 | W202_#02 | W202_#03 | W202_#04 | W202_#05 | W202_#06 | W202_#07 | W202_#08 | W202_#09 | W202_#10 |
| W202_#01 | - | |||||||||
| W202_#02 | 0.0139 | - | ||||||||
| W202_#03 | 0.0200 | 0.0157 | - | |||||||
| W202_#04 | 0.0142 | 0.022 | 0.0140 | - | ||||||
| W202_#05 | 0.0119 | 0.0059 | 0.0119 | 0.0259 | - | |||||
| W202_#06 | 0.0139 | 0 | 0.0157 | 0.0219 | 0.0059 | - | ||||
| W202_#07 | 0.0139 | 0 | 0.0157 | 0.0219 | 0.0059 | 0 | - | |||
| W202_#08 | 0.0122 | 0.0239 | 0.0160 | 0.0061 | 0.0239 | 0.0239 | 0.0239 | - | ||
| W202_#09 | 0.0119 | 0.0019 | 0.0137 | 0.0199 | 0.0078 | 0.0019 | 0.0019 | 0.0219 | - | |
| W202_#10 | 0.0100 | 0.0176 | 0.0177 | 0.0080 | 0.0176 | 0.0176 | 0.0176 | 0.0060 | 0.0157 | - |
| Average | 0,0135 | |||||||||
| P. (A.) karindus | V145_#01 | V145_#02 | V145_#03 | V145_#04 | V145_#05 | V145_#06 | V145_#07 | V145_#08 | V145_#09 | V145_#10 |
| V145_#01 | - | |||||||||
| V145_#02 | 0.0019 | - | ||||||||
| V145_#03 | 0.0078 | 0.0059 | - | |||||||
| V145_#04 | 0.0078 | 0.0059 | 0 | - | ||||||
| V145_#05 | 0.0059 | 0.0039 | 0.0019 | 0.0019 | - | |||||
| V145_#06 | 0.0059 | 0.0059 | 0.0078 | 0.0059 | 0.0078 | - | ||||
| V145_#07 | 0.0078 | 0.0098 | 0.0078 | 0.0078 | 0.0078 | 0.0137 | - | |||
| V145_#08 | 0.0019 | 0 | 0.0059 | 0.0059 | 0.0039 | 0.0059 | 0.0098 | - | ||
| V145_#09 | 0.0039 | 0.0019 | 0.0039 | 0.0039 | 0.0059 | 0.0019 | 0.0117 | 0.0019 | - | |
| V145_#10 | 0.0059 | 0.0039 | 0.0078 | 0.0059 | 0.0078 | 0.0039 | 0.0137 | 0.0039 | 0.0019 | - |
| Average | 0,0056 | |||||||||
| P. (A.) karindus | Z704_#01 | Z704_#02 | Z704_#03 | Z704_#04 | Z704_#05 | Z704_#06 | Z704_#07 | Z704_#08 | Z704_#09 | Z704_#10 |
| Z704_#01 | - | |||||||||
| Z704_#02 | 0.0019 | - | ||||||||
| Z704_#03 | 0.0019 | 0 | - | |||||||
| Z704_#04 | 0.0019 | 0 | 0 | - | ||||||
| Z704_#05 | 0.0098 | 0.0078 | 0.0078 | 0.0078 | - | |||||
| Z704_#06 | 0.0098 | 0.0078 | 0.0078 | 0.0078 | 0 | - | ||||
| Z704_#07 | 0.0117 | 0.0098 | 0.0098 | 0.0098 | 0.0019 | 0.0019 | - | |||
| Z704_#08 | 0.0039 | 0.0019 | 0.0019 | 0.0019 | 0.0059 | 0.0059 | 0.0078 | - | ||
| Z704_#09 | 0.0039 | 0.0019 | 0.0019 | 0.0019 | 0.0059 | 0.0059 | 0.0078 | 0 | - | |
| Z704_#10 | 0.0141 | 0.0162 | 0.0162 | 0.0162 | 0.0162 | 0.0162 | 0.0182 | 0.0182 | 0.0182 | - |
| Average | 0,0072 | |||||||||
| P. (A.) morgani | V127_#01 | V127_#02 | V127_#03 | V127_#04 | V127_#05 | V127_#06 | V127_#07 | V127_#08 | V127_#09 | V127_#10 |
| V127_#01 | - | |||||||||
| V127_#02 | 0.0101 | - | ||||||||
| V127_#03 | 0.0289 | 0.0307 | - | |||||||
| V127_#04 | 0.0267 | 0.0328 | 0.0083 | - | ||||||
| V127_#05 | 0.0122 | 0.0141 | 0.0368 | 0.0246 | - | |||||
| V127_#06 | 0.0041 | 0.0101 | 0.0267 | 0.0205 | 0.0121 | - | ||||
| V127_#07 | 0.0144 | 0.0246 | 0.0083 | 0.0083 | 0.0266 | 0.0185 | - | |||
| V127_#08 | 0.0165 | 0.0266 | 0.0104 | 0.0104 | 0.0246 | 0.0246 | 0.0146 | - | ||
| V127_#09 | 0.0226 | 0.0328 | 0.0083 | 0.0041 | 0.0287 | 0.0267 | 0.0083 | 0.0104 | - | |
| V127_#10 | 0.0124 | 0.0226 | 0.0104 | 0.0104 | 0.0267 | 0.0165 | 0.0021 | 0.0167 | 0.0104 | - |
| Average | 0,0177 | |||||||||
There were 11 single-base substitutions, 3 mono and 4 multi-nucleotide indels, in clones of specimen W136 (P. (A.) peilei). Interestingly, that clone “W136_#08” differed significantly from all others in having 16-nycleotide polyT deletion at positions “329-344” and 3 base indel at position “171-173”. Clones of second specimen P. (A.) peilei (W202) had 8 sites with single nucleotide substitutions and 8 positions, where mono multi-nucleotide indels occurred. Three clones had large polymorphic 17-nucleotide indel at positions “184-200”. Variation among clones was significant, with intragenomic differences ranging from 0.0% to 2.39%. The average intragenomic genetic distances for two specimens of P. (A.) peilei (W136 and W202) were very similar: 1.34% and 1.35% respectively.
P. (A.) karindus had significantly lower rate of intragenomic variability. Specimens V145 and Z704 had 9 and 10 polymorphic positions, respectively. Furthermore, majority number of indels and base substitutions of Z704 specimen is accounted for by one clone (Z704#10). It has one single substitution and 3 multi-nucleotide deletions, which never occurred in other clones. The average intragenomic genetic distances for two specimens of P. (A.) karindus (V145 and Z704) were: 0.56% and 0.72%, respectively. The highest value was 1.82%.
Clones of P. (A.) morgani ITS2 showed greater diversity than the other 2 species. For instance, the genetic distance between V127#05 clone and V127#03 was 3.68%. The average intragenomic genetic distance was also significantly higher for this species – 1.77%
In Bayesian analysis 50 cloned amplicons from P. (A.) peilei, P. (A.) karindus, P. (A.) morgani and ITS2 sequences from all Agrodiaetus species available in the GenBank were included, giving a total of 127 sequences. Since Polyommatus icarus (Rottemburg, 1775) was earlier inferred as sister clade to the subgenus Agrodiaetus (
Fragment of consensus Bayesian tree of the subgenus Agrodiaetus inferred from ITS2 sequences. Posterior probability values >50% are shown. The complete tree is given online in the Suppl. material
Despite the popularity of the ITS2 nuclear rDNA marker in systematics of different groups of animals and plants, its variability on intraspecific and intraindividual level is still poorly known. The occurrence of multiple ITS2 copies within a single genome should be accounted for before rDNA is used for phylogenetic or population studies. Furthermore, investigation of rates of intra-individual polymorphism can lighten addressing questions regarding speciation, species hybridization end evolutionary history. It is generally considered that multigene families, such as rDNA maintain homogeneity of all copies as a result of concerted evolution (processes of gene conversion and unequal crossing over) (
Here we contribute with the first insight into the intraspecific ITS2 diversity in the blue butterflies of subgenus Agrodiaetus.
The ITS2 of all specimens of three Agrodiaetus species - (P. (A.) peilei, P. (A.) karindus and P. (A.) morgani) were intragenomically variable. There were a number of indels and base substitutions accounting for both the length and sequence variabilities. Numerous indels lead to length variation (477-512 bp) of studied sequences. Bayesian phylogenetic reconstruction revealed that cloned sequences of certain individuals did not form a monophyletic unanimity, but the majority of clones clustered together within species borders. In particular, clones of P. (A.) peilei and P. (A.) karindus individuals are recovered as two distinct separated clusters, both with a Bayesian posterior probability of 1.00. The position of 6 clones of P. (A.) morgani specimen on the ITS2 tree support the conclusion that abovementioned species belong to “antidolus” species-group which comprise 5 allopatric in distribution, closely related taxa: P. (A.) femininoides (Eckweiler, 1987), P. (A.) antidolus (Rebel, 1901), P. (A.) aereus (Eckweiler, 1998), P. (A.) kurdistanicus (Forster, 1961) and P. (A.) morgani. “Antidolus” clade revealed with a high level of posterior probability. However, when considering all cloning data, in some cases differences between cloned sequences of the same individual were greater than that between species. For instance, the remainder of P. (A.) morgani clones are placed as the basal taxa to clade, consist of P. (A.) guezelmavi (Olivier, Puplesiene, van der Poorten, De Prins & Wiemers, 1999), P. (A.) dama (Staudinger, 1892) and majority of P. (A.) peilei and P. (A.) karindus clones. One clone of P. (A.) karindus (Z704_#08) also was recovered as sister taxa to abovementioned clade. Finally, W136_#08 clone of P. (A.) peilei is found to be more genetically distant from other clones of this individual than the great number of other species of the subgenus Agrodiaetus (Figure
Recent works showed that tandem arrays of rRNA genes in most Lepidoteran species form one or two so-called rDNA clusters, although some exceptions in cluster number exist (
To conclude, our study demonstrates that the results of direct sequencing may not describe the actual and entire set of sequence variants. Level of divergence between clones of one individual can be comparable to interspecific genetic differences variations or even exceed them. Hence, cloning and subsequent intraindividual haplotypes handling are required for reliable phylogenetic reconstructions.
The complete financial support for this study was provided by the grant from the Russian Science Foundation no. 14-14-00541 to the Zoological Institute of Russian Academy of Sciences. We thank Boris Anokhin and Alsu Saifitdinova for help in DNA cloning. The work was partially performed using equipment of the ‘Chromas’ Core Facility and Centre for Molecular and Cell Technologies of St. Petersburg State University. Postdoctoral fellowship was provided to Nazar Shapoval from St. Petersburg State University.
Consensus Bayesian tree of the subgenus Polyommatus (Agrodiaetus) inferred from ITS2 sequences
Data type: TIFF image
Explanation note: Consensus Bayesian tree of the subgenus Polyommatus (Agrodiaetus) inferred from ITS2 sequences. Posterior probability values >50% are shown.