Research Article
Print
Research Article
Chromosomal and DNA barcode analysis of the Polyommatus (Agrodiaetus) damone (Eversmann, 1841) species complex (Lepidoptera, Lycaenidae)
expand article infoVladimir A. Lukhtanov, Alexander V. Dantchenko§
‡ Zoological Institute of the Russian Academy of Sciences, St. Petersburg, Russia
§ Lomonosov Moscow State University, Moscow, Russia
Open Access

Abstract

The Polyommatus (Agrodiaetus) damone (Eversmann, 1841) species complex comprises from 5 to 8 species distributed in southeastern Europe and southern Siberia. Here we used chromosomal and DNA-barcode markers in order to test the taxonomic hypotheses previously suggested for this complex. We revealed that all taxa within this group demonstrate chromosomal stasis and share the same or very similar haploid chromosome number (n = 66 or n = 67). This finding is unexpected since the karyotypes are known to be very diverse and species-specific within the other taxa of the subgenus Agrodiaetus Hübner, 1822. Analysis of the mitochondrial gene COI revealed six diverged clusters of individuals within the complex. Each cluster has a specific geographic distribution and is characterized by distinct morphological features in the wing pattern. The clusters mostly (but not always) correlate with traditionally recognized species. As a result of our study, we describe a new subspecies P. (A.) iphigenides zarmitanus subsp. nov. from Uzbekistan and Tajikistan and show that the taxon originally described as Lycaena kindermanni var. melania Staudinger, 1886 represents a subspecies P. (A.) iphigenides melanius (Staudinger, 1886). Polyommatus (A.) samusi Korb, 2017 (syn. nov.) and P. (A.) melanius komarovi Korb, 2017 (syn. nov.) are considered here as junior subjective synonyms of P. (A.) iphigenides iphigenides (Staudinger, 1886).

Keywords

Agrodiaetus, chromosomal stasis, chromosome, COI, DNA barcoding, karyosystematics, taxonomy

Introduction

The Polyommatus (Agrodiaetus) damone (Eversmann, 1841) species complex is a monophyletic group (Vershinina and Lukhtanov 2017) that comprises from 5 to 8 species distributed in SE Europe, Central Asia and S Siberia (Eckweiler and Bozano 2016). The taxa of the complex were previously revised by Staudinger (1899), Forster (1956, 1960), Dantchenko and Lukhtanov (1993) and Dantchenko (1997). There are also limited molecular (Wiemers 2003; Kandul et al. 2004, 2007; Lukhtanov et al. 2005, 2009; Vodolazhsky et al. 2011; Vodolazhsky and Stradomsky 2012) and chromosomal (Lukhtanov 1989; Kandul 1997; Lukhtanov et al. 1997; Lukhtanov and Dantchenko 2002a; Lukhtanov et al. 2005) data for a few taxa of the complex. However, the complex has never been systematically studied by using chromosomal and molecular markers, although such an approach is considered as an essential requirement for revealing taxonomic structure in the subgenus Agrodiaetus (Lukhtanov and Dantchenko 2002b; Kandul et al. 2004).

Here we analyzed karyotypes and mitochondrial DNA-barcodes of all species of the P. (A.) damone complex in order to test the taxonomic hypotheses previously suggested for this group (see the references above).

The taxa P. (A.) damone walteri Dantchenko et Lukhtanov, 1993, P. (A.) damone fabiani Bálint, 1997 and P. (A.) damone bogdoolensis Dantchenko et Lukhtanov, 1997 are not considered in this paper since neither chromosomal nor molecular data are available. This also applies to P. (A.) carmon altaiensis (Forster, 1956), recently treated by Eckweiler and Bozano (2016) as a separate species. All these taxa represent the most eastern populations of the P. (A.) damone complex distributed in Mongolia, Altai and southwestern Siberia. Morphologically they are close to other populations of P. damone or to P. mediator Dantchenko et Churkin, 2003. Their study will become possible in the future as soon as the material suitable for molecular and chromosomal analyses becomes available.

Material and methods

Molecular methods and DNA barcode analysis

Standard COI barcodes (658-bp 5' segment of mitochondrial cytochrome oxidase subunit I) were studied. COI sequences were obtained from 44 specimens representing the P. damone species group and from two samples [P. damon (Denis et Schiffermüller, 1775) and P. icarus (Rottemburg, 1975)] which were selected as outgroup (Table 1). Legs were sampled from these specimens, and sequence data from the DNA barcode region of COI were obtained at the Canadian Centre for DNA Barcoding (CCDB, Biodiversity Institute of Ontario, University of Guelph) using protocols described in Hajibabaei et al. (2005), Ivanova et al. (2006) and deWaard et al. (2008). Specimens examined are deposited in the Zoological Institute of the Russian Academy of Sciences, St. Petersburg, Russia and in the McGuire Center for Lepidoptera and Biodiversity (MGCL), Florida Museum of Natural History, University of Florida, Gainesville, Florida, USA. Photographs of these specimens, as well as collecting data are available in the Barcode of Life Data System (BOLD), projects Butterflies of Palearctic (BPAL) and Butterflies of Palearctic Part B (BPALB) at http://www.boldsystems.org/.

We also used 31 published COI sequences (Wiemers 2003; Kandul et al. 2004, 2007; Lukhtanov et al. 2005, 2009; Vodolazhsky et al. 2011; Vodolazhsky and Stradomsky 2012) which were downloaded from GenBank (Table 1).

Table 1.

Specimens of the Polyommatus (Agrodiaetus) damone complex used in the DNA-barcode analysis.

Species and subspecies Sequence code Field code GenBank number Country Locality Reference
P. damon FJ663230 n/a FJ663230 Kazakhstan Altai Lukhtanov et al. 2009
P. damone altaicus FJ663229 LOWA298-06 FJ663229 Kazakhstan Saur-Tarbagatai Mts Lukhtanov et al. 2009
P. damone altaicus FJ663228 LOWA299-06 FJ663228 Kazakhstan Saur-Tarbagatai Mts Lukhtanov et al. 2009
P. damone altaicus BPAL3395-16 CCDB-25452_F10 MW186990 Russia Altai, Jarbalyk This study
P. damone altaicus BPAL838-11 CCDB-05724_G06 MW186700 Kazakhstan Saur Mts, Saikan This study
P. damone altaicus BPAL839-11 CCDB-05724_G07 MW186701 Kazakhstan Saur Mts, Saikan This study
P. damone altaicus AY496734 n/a AY496734 Russia Altai, Aktash Kandul et al. 2004
P. damone altaicus BPAL3394-16 CCDB-25452_F09 MW186989 Russia Altai, Chemal This study
P. damone BPAL836-11 CCDB-05724_G04 MW186988 Russia Volga, Volsk This study
P. damone BPAL837-11 CCDB-05724_G05 MW186992 Russia Volga, Volsk This study
P. damone BPAL835-11 CCDB-05724_G03 MW186999 Russia Volga, Akulovka This study
P. damone AY496735 n/a AY496735 Russia South Urals, Guberli Mts, Adaevo Kandul et al. 2004
P. damone irinae BPAL833-11 CCDB-05724_G01 MW186997 Russia Volgograd Region, Olkhovka This study
P. damone irinae BPAL834-11 CCDB-05724_G02 MW186998 Russia Volgograd Region, Olkhovka This study
P. damone irinae AY496736 n/a AY496736 Russia Volgograd Region, Olkhovka Kandul et al. 2004
P. damone pljushtchi AY496774 n/a AY496774 Russia Crimea, Ai Petri Kandul et al. 2004
P. damone ssp. BPAL524-11 n/a MW186991 Kazakhstan Karaganda Region, Akchatau This study
P. damone tanais BPAL825-11 CCDB-05724_F05 MW186993 Ukraine Amvrosievka This study
P. damone tanais BPAL826-11 CCDB-05724_F06 MW186994 Ukraine Amvrosievka This study
P. damone tanais BPAL827-11 CCDB-05724_F07 MW186995 Ukraine Amvrosievka This study
P. damone tanais BPAL828-11 CCDB-05724_F08 MW186996 Ukraine Amvrosievka This study
P. damone tanais KC692328 n/a KC692328 Russia Rostov Region, Belaya Kalitva Vodolazhsky and Stradomsky 2012
P. icarus HM913968 n/a HM913968 Italy 39.9919°N, 15.7931°E GenBank
P. iphigenides P. iphigenides n/a LOWA422-06 FJ663238 Kyrgyzstan Transalai Mts, Nura Lukhtanov et al. 2009
P. iphigenides iphigenides n/a LOWA423-06 FJ663237 Kyrgyzstan Transalai Mts, Nura Lukhtanov et al. 2009
P. iphigenides iphigenides n/a LOWA424-06 FJ663236 Kyrgyzstan Transalai Mts, Nura Lukhtanov et al. 2009
P. iphigenides iphigenides n/a LOWA514-06 FJ663235 Kyrgyzstan Alai, Tengizbai Pass Lukhtanov et al. 2009
P. iphigenides iphigenides n/a LOWA515-06 FJ663234 Kyrgyzstan Alai, Tengizbai Pass Lukhtanov et al. 2009
P. iphigenides iphigenides BPAL1586-12 CCDB-03032_F06 MW194007 Tajikistan Iskanderkul This study
P. iphigenides iphigenides BPAL1587-12 CCDB-03032_F07 MW194008 Tajikistan Iskanderkul This study
P. iphigenides iphigenides AY496758 n/a AY496758 Kazakhstan Shymkent Region, Ugamski Mts Kandul et al. 2004
P. iphigenides iphigenides AY557155 WE98001 AY557155 Kyrgyzstan 25 km S Song Kul Lake Wiemers 2003
P. iphigenides melanius BPALB479-18 CCDB-23848_A04 MW186954 Tajikistan Alai Mts, Jirgatol This study
iphigenides melanius BPALB480-18 CCDB-23848_A05 MW186955 Tajikistan Alai Mts, Jirgatol This study
P. iphigenides melanius BPALB481-18 CCDB-23848_A06 MW186956 Tajikistan Alai Mts, Jirgatol This study
P. iphigenides melanius BPALB482-18 CCDB-23848_A07 MW186957 Tajikistan Alai Mts, Jirgatol This study
P. iphigenides melanius BPALB483-18 CCDB-23848_A08 MW186958 Tajikistan Alai Mts, Jirgatol This study
P. iphigenides melanius BPALB484-18 CCDB-23848_A09 MW186959 Tajikistan Alai Mts, Jirgatol This study
P. iphigenides melanius BPALB556-18 CCDB-23848_G09 MW186960 Tajikistan Peter I Mts, Khorakul Lake This study
P. iphigenides melanius BPALB558-18 CCDB-23848_G11 MW186961 Tajikistan Peter I Mts, Mingbulak This study
P. iphigenides melanius BPALB559-18 CCDB-23848_G12 MW186962 Tajikistan Peter I Mts, Mingbulak This study
P. iphigenides zarmitanus BPAL1390-12 CCDB-03030_E12 MW186963 Uzbekistan Nuratau Mts, Zarmitan This study
P. iphigenides zarmitanus BPAL1391-12 CCDB-03030_F01 MW186964 Uzbekistan Nuratau Mts, Zarmitan This study
P. iphigenides zarmitanus BPAL1392-12 CCDB-03030_F02 MW186965 Uzbekistan Nuratau Mts, Zarmitan This study
P. iphigenides zarmitanus BPAL1394-12 CCDB-03030_F04 MW186967 Uzbekistan Nuratau Mts, Zarmitan This study
P. iphigenides zarmitanus BPAL1514-12 CCDB-03031_H05 MW186968 Uzbekistan Hissar Range, Tamshush This study
P. iphigenides zarmitanus BPAL1515-12 CCDB-03031_H06 MW186969 Uzbekistan Hissar Range, Tamshush This study
P. iphigenides zarmitanus BPAL1533-12 CCDB-03032_B01 MW186970 Uzbekistan Hissar Range, Sangardak This study
P. iphigenides zarmitanus BPAL1534-12 CCDB-03032_B02 MW186971 Uzbekistan Hissar Range, Sangardak This study
P. iphigenides zarmitanus BPAL1535-12 CCDB-03032_B03 MW186972 Uzbekistan Hissar Range, Sangardak This study
P. iphigenides zarmitanus BPAL1536-12 CCDB-03032_B04 MW186973 Uzbekistan Hissar Range, Sangardak This study
P. iphigenides zarmitanus BPAL1544-12 CCDB-03032_B12 MW186974 Uzbekistan Hissar Range, Tamshush This study
P. iphigenides zarmitanus AY556853 DS01001 AY556853 Uzbekistan Kitabsky reserve Wiemers 2003
P. iphigenides zarmitanus (Holotype) BPAL1393-12 CCDB-03030_F03 MW186966 Uzbekistan Nuratau Mts, Zarmitan This study
P. juldusus BPAL852-11 CCDB-05724_H08 MW186985 Kazakhstan Almaty Region, Kegen Pass This study
P. juldusus BPAL870-11 CCDB-05725_B03 MW186986 Kyrgyzstan Issykkyl, Kadzhisai This study
P. juldusus kasachstanus AY496759 n/a AY496759 Kazakhstan Dzhungarian Alatau Kandul et al. 2004
P. juldusus kirgisorum BPAL1381-12 CCDB-03030_E03 MW186987 Kyrgyzstan Shamsi This study
P. karatavicus BPAL040-10 RPVL-00040 MW186975 Kazakhstan Karatau Mts, Minzhilgi This study
P. karatavicus BPAL041-10 RPVL-00041 MW186976 Kazakhstan Karatau Mts, Minzhilgi This study
P. karatavicus BPAL042-10 RPVL-00042 MW186977 Kazakhstan Karatau Mts, Minzhilgi This study
P. karatavicus BPAL1388-12 CCDB-03030_E10 MW186978 Kazakhstan Karatau Mts This study
P. karatavicus AY496760 n/a AY496760 Kazakhstan Karatau Mts Kandul et al. 2004
P. mediator habievi JF343830 ILL087 JF343830 Mongolia Arshantyn-Nuruu Mts Vodolazhsky et al. 2011
P. mediator habievi JF343829 ILL086 JF343829 Mongolia Bayan Ulegei aimak, Elt Gol river Vodolazhsky et al. 2011
P. mediator mediator EF104602 n/a EF104602 Mongolia Altai Mts, Biger Kandul et al. 2004
P. phyllides askhabadicus BPAL864-11 CCDB-05725_A09 MW186983 Iran Kuh e Sorkh Mts, Fariman This study
P. phyllides askhabadicus BPAL865-11 CCDB-05725_A10 MW186984 Iran Kuh e Sorkh Mts, Fariman This study
P. phyllides askhabadicus AY954011 n/a AY954011 Iran Khorasan, Chakane Lukhtanov et al. 2005
P. phyllides kentauensis BPAL1382-12 CCDB-03030_E04 MW186980 Kazakhstan Karatau Mts This study
P. phyllides kentauensis AY496769 n/a AY496769 Kazakhstan Karatau Mts Kandul et al. 2004
P. phyllides phyllides FJ663239 LOWA633-06 FJ663239 Tajikistan Iskanderkul Lukhtanov et al. 2009
P. phyllides phyllides BPAL1328-12 CCDB-03029_H09 MW186979 Uzbekistan Sairob This study
P. phyllides phyllides BPAL1578-12 CCDB-03032_E10 MW186981 Tajikistan Iskanderkul This study
P. phyllides phyllides BPAL2660-14 CCDB-17967_H11 MW186982 Tajikistan Sarsaryak This study
P. phyllides phyllides FJ663240 LOWA571-06 FJ663240 Uzbekistan Nuratau Mts, Zarmitan Lukhtanov et al. 2009
P. phyllides phyllides AY496771 n/a AY496771 Kazakhstan Karzhantau Mts Kandul et al. 2004
P. phyllides phyllides AY496770 n/a AY496770 Kazakhstan Kirgizski Range Kandul et al. 2004

Sequences were aligned using the BioEdit software (Hall 1999) and edited manually. Phylogenetic hypotheses were inferred using Bayesian inference as described previously (Vershinina and Lukhtanov 2010; Przybyłowicz et al. 2014; Lukhtanov et al. 2016). Briefly, the Bayesian analysis was performed using the program MrBayes 3.2 (Ronquist et al. 2012) with default settings as suggested by Mesquite (Maddison and Maddison 2015): burn-in = 0.25, nst = 6 (GTR + I + G). Two runs of 10,000,000 generations with four chains (one cold and three heated) were performed. We checked runs for convergence and proper sampling of parameters [effective sample size (ESS) > 200] using the program tracer v1.7.1 (Rambaut et al. 2018). The first 25% of each run was discarded as burn-in. The consensus of the obtained trees was visualized using FigTree 1.3.1 (http://tree.bio.ed.ac.uk/software/figtree/).

Chromosomal analysis

Karyotypes were studied in 16 adult males representing four species (Table 2) and were processed as previously described (Lukhtanov et al. 2014; Vishnevskaya et al. 2016). Briefly, gonads were removed from the abdomen and placed into freshly prepared fixative (3:1; 96% ethanol and glacial acetic acid) directly after capturing the butterfly in the field. Testes were stored in the fixative for 3–36 months at +4 °C. Then the gonads were stained in 2% acetic orcein for 30–60 days at +18–20 °C. Different stages of male meiosis, including metaphase I (MI) and metaphase II (MII) were examined using an original two-phase method of chromosome analysis (Lukhtanov et al. 2006, 2008). Abbreviation ca (circa) means that the count was made with an approximation due to an insufficient quality of preparation or overlapping of some chromosomes or bivalents.

Table 2.

Chromosome numbers of species of the Polyommatus (Agrodiaetus) damone complex collected by A. Dantchenko (AD), V. Lukhtanov (AV), and Yu. Budashkin and N. Kandul (B & K).

Species ID number Chromo-some number Country Locality date Collector Reference
P. damone altaicus 1987-445 n = ca65 Russia Altai Mts, Tshulyshman River, 500 m 3–10 August 1987 VL Lukhtanov 1989
P. damone altaicus 1997-1 n = ca65-67 Kazakhstan near Zaisan city 23 June 1997 VL Lukhtanov and Dantchenko 2002a
P. damone altaicus 1997-2 n = 67 Kazakhstan Saur Mts, Saikan 2–3 July 1997 VL Lukhtanov and Dantchenko 2002a
P. damone damone 94001 n = 66-67 Russia Saratov Region, near Volsk July 1994 AD Lukhtanov et al. 1997
P. damone damone 94002 n = 67 Russia Saratov Region, near Volsk July 1994 AD Lukhtanov et al. 1997
P. damone damone 94003 n = 66 Russia Saratov Region, near Volsk July 1994 AD Lukhtanov et al. 1997
P. damone damone 94008 n = 67 Russia Saratov Region, near Volsk July 1994 AD Lukhtanov et al. 1997
P. damone damone 94010 n = ca66-67 Russia Saratov Region, near Radishevo July 1994 AD This study
P. damone damone 95DG5 n = ca67 Russia South Ural, Kuvandyk 1995 AD This study
P. damone damone 95DG6 n = ca66-67 Russia South Ural, Kuvandyk 1995 AD This study
P. damone irinae AD00P077 n = ca67 Russia Volgograd region July 2000 AD Kandul et al. 2007
P. damone pljushtchi 95051 n = 65-67 Russia Crimea, Ai-Petri, 1200 m 14 July 1995 B & K Kandul 1997
P. damone pljushtchi 95054 n = ca66-68 Russia Crimea, Ai-Petri, 1200 m 14 July 1995 B & K Kandul 1997
P. damone pljushtchi 95055 n = ca65-67 Russia Crimea, Ai-Petri, 1200 m 14 July 1995 B & K Kandul 1997
P. damone pljushtchi 96009 n = ca65-66 Russia Crimea, Ai-Petri, 1200 m 10 July 1995 B & K Kandul 1997
P. damone pljushtchi 96010 n = 67 Russia Crimea, Ai-Petri, 1200 m 10 July 1995 B & K Kandul 1997
P. damone pljushtchi 96011 n = 65 Russia Crimea, Ai-Petri, 1200 m 10 July 1995 B & K Kandul 1997
P. damone pljushtchi 96012 n = 66-67 Russia Crimea, Ai-Petri, 1200 m 10 July 1995 B & K Kandul 1997
P. damone pljushtchi 96017 n = ca66-68 Russia Crimea, Ai-Petri, 1200 m 10 July 1995 B & K Kandul 1997
P. damone pljushtchi 95050 n = 66-67 Russia Crimea, Ai-Petri, 1200 m 14 July 1995 B & K Kandul 1997
P. damone tanais 95005 n = ca67 Ukraine Don River basin, Shirokaya balka 26 May 1995 AD This study
P. iphigenides iphigenides irkeshtam n = ca66-67 Kyrgyzstan Transalai Mts (east), Irkeshtam 1996 VL Lukhtanov and Dantchenko 2002a
P. iphigenides iphigenides 1996-4 n = ca66-67 Kyrgyzstan Naryn Region, Chaek 4 July 1996 VL This study
P. iphigenides iphigenides 1996-3 n = ca66 Kyrgyzstan Moldatoo Mts, Teke-Uyuk 30 June 1996 VL This study
P. iphigenides iphigenides 1995 – Chiitala n = 67 Kyrgyzstan Alai Mts, Chiitala village, 2300 m 1995 VL Lukhtanov and Dantchenko 2002a
P. iphigenides iphigenides 1994-1 n = ca66-67 Tajikistan Iskanderkul July 1994 VL This study
P. iphigenides iphigenides 95205 n = ca66-67 Kyrgyzstan Alai Mts, Chiitala village, 2300 m 1995 VL Lukhtanov and Dantchenko 2002a
P. iphigenides iphigenides NK00P823 AY496758 n = ca65-67 Kazakhstan Ugamski range June 2000 VL Lukhtanov et al. 2005
P. iphigenides melanius 068K18A n = 66 Tajikaistan Alai Mts, Jirgatol July 2018 AD This study
P. iphigenides melanius 077K18A n = 67 Tajikaistan Alai Mts, Jirgatol July 2018 AD This study
P. iphigenides melanius Tj002 n = 66 Tajikaistan Peter I Mts July 20218 VL This study
P. iphigenides zarmitanus 94L01 n = ca66-68 Uzbekistan Nuratau Mts, Zarmitan, 1300 m 11–13 June 1994 VL This study
P. iphigenides zarmitanus 94L03 n = ca68 Uzbekistan Nuratau Mts, Zarmitan, 1300 m 11–13 June 1994 VL This study
P. iphigenides zarmitanus 94L04 n = 67 Uzbekistan Nuratau Mts, Zarmitan, 1300 m 11–13 June 1994 VL This study
P. iphigenides zarmitanus 94L54 n = ca66-67 Uzbekistan Hissar Range, Sangardak, 1600 n 2 July 1994 VL Lukhtanov and Dantchenko 2002a
P. iphigenides zarmitanus 94L61 n = 67 Uzbekistan Hissar Range, Tamshush, 1800 n 5–7 July 1994 VL Lukhtanov and Dantchenko 2002a
P. iphigenides zarmitanus 94L64 n = 66 Uzbekistan Hissar Range, Tamshush, 1800 n 5–7 July 1994 VL Lukhtanov and Dantchenko 2002a
P. iphigenides zarmitanus 94L74 n = ca65-67 Uzbekistan Samarkand Region, Aman-Kutan 7 July 1994 VL Lukhtanov and Dantchenko 2002a
P. iphigenides zarmitanus 94L75 n = ca65-67 Uzbekistan Samarkand Region, Aman-Kutan 7 July 1994 VL Lukhtanov and Dantchenko 2002a
P. iphigenides zarmitanus 1994-2 n = 67 Uzbekistan Nuratau Mts, Zarmitan, 1300 m 11–13 June 1994 VL This study
P. iphigenides zarmitanus 1994-3 n = 67 Uzbekistan Tamshush 1994 VL Lukhtanov and Dantchenko 2002a
P. iphigenides zarmitanus 1994-4 n = 67 Uzbekistan Samarkand Region, Aman-Kutan 7 July 1994 VL Lukhtanov and Dantchenko 2002a
P. juldusus kasachstanus 1997-3 n = 67 Kazakhstan Dzhungarian Alatau, Kysylagash June 2000 VL Lukhtanov and Dantchenko 2002a
P. karatavicus 2000-K n = 67 Kazakhstan Karatau Mts, Minzhilgi June 2000 VL Lukhtanov et al. 2005
P. phyllides askhabadicus F456 n = ca66-67 Iran Kuh-e-Sorkh Mts., Torbat-e-Heydariyeh 7 July 2003 VL&D This study
P. phyllides askhabadicus VL03F523 AY954011 n = 67 Iran Khorasan, Chakane 9 July 2003 VL&D This study
P. phyllides phyllides 95204 n = ca65-67 Kyrgyzstan Naryn Region, Moldatoo Mts, Chon-Konduk 26 July 1995 VL This study
P. phyllides phyllides NK00P672 AY496770 n = ca66-67 Kazakhstan Kazakhstan, Kirgizski range, June 2000 VL Lukhtanov and Dantchenko 2002a
P. phyllides phyllides NK00P808 AY496771 n = ca66-67 Kazakhstan Kazakhstan, Karzhantau mts June 2000 VL Lukhtanov and Dantchenko 2002a

Leica DM2500 light microscope equipped with HC PL APO 100×/1.44 Oil CORR CS lens and S1/1.4 oil condenser head was used for bright-field microscopy analysis. Leica DM2500 light microscope equipped with HC PL APO 100×/1.40 OIL PH3 lens was used for phase-contrast microscopy analysis.

Results

DNA-barcode analysis

Phylogenetic analysis revealed six clusters of closely related individuals within the P. (A.) damone species complex (Fig. 1). Of these clusters, four groups were monophyletic and two groups were paraphyletic. The lineages of P. (A.) damone (I) and P. (A.) karatavicus Lukhtanov, 1990 (V) were highly supported. The lineage of P. (A.) phyllides (Staudinger, 1886) (VI) and the lineage [(P. (A.) mediator Dantchenko et Churkin, 2003 + P. (A.) juldusus kasachstanus Lukhtanov et Dantchenko, 1994)] (II) had medium support. The clusters III [P. (A.) iphigenides iphigenides (Staudinger, 1886) + P. (A.) iphigenides melanius (Staudinger, 1886)] and VI (P. (A.) iphigenides zarmitanus subsp. nov.) appeared on the tree as two distinct, not closely related paraphyletic taxa.

Figure 1.

The Bayesian majority rule consensus tree of the analyzed samples of Polyommatus (Agrodiaetus) inferred from COI sequences. Polyommatus icarus is used to root the tree (not shown). Species and subspecies names, GenBank accession numbers, museum ID numbers and localities are shown to the right of the branches. Bayesian posterior probabilities higher than 0.5 are shown next to the recovered branches. 1–6 are clusters (see explanation in the text).

Chromosomal analysis

Chromosomal analysis of three males of P. (A.) damone damone, of a single male of P. (A.) damone tanais Dantchenko et Pljushtch, 1993, of two males of P. (A.) iphigenides iphigenides, of three males of P. (A.) iphigenides melanius, of a single male of P. (A.) phyllides phyllides, of two males of P. (A.) phyllides askhabadicus (Forster, 1960) and four males of P. (A.) iphigenides zarmitanus subsp. nov. revealed the same (or almost the same) haploid chromosome number n = 66 or n = 67 in all studied taxa (Table 2). The karyotype structure was also found to be identical in all studied individuals, with three large bivalents in the center of metaphase plates (Fig. 2). Bivalent 1 was 1.2–1.5 times larger than bivalent 2, and the latter was 1.2–1.5 times larger than bivalent 3.

Figure 2.

Karyotypes of Polyommatus (Agrodiaetus) iphigenides melanius and P. (A.) phyllides askhabadicus a P. (A.) iphigenides melanius, sample 077K18A, MI, n = 67, phase-contrast b P. (A.) iphigenides melanius, sample 068K18A, MI, n = 66 c P. (A.) phyllides askhabadicus, sample F523, MI, n = 67. Scale Bar: 10 μm.

Discussion

Chromosomal stasis

It has been found that all taxa within P. (A.) damone species complex demonstrate chromosomal stasis and share the same or very similar haploid chromosomal number (n = 66 or n = 67). This result is unexpected since the karyotypes are known to be very diverse and species-specific in the subgenus Agrodiaetus.

It is believed that an unusual diversity of karyotypes is the most remarkable characteristic of Agrodiaetus. Species of this subgenus exhibit one of the highest ranges in chromosome numbers in the animal kingdom (Vershinina and Lukhtanov 2017). In Agrodiaetus haploid chromosome numbers (n) range from n = 10 in P. (A.) caeruleus (Staudinger, 1871) to n = 134 in P. (A.) shahrami (Skala, 2001) (Lukhtanov et al. 2005). The genus Polyommatus as a whole shows numbers from n = 10 to n = 226 (Lukhtanov 2015). Additionally, the subgenus Agrodiaetus demonstrates a high level of karyotypic differentiation with respect to chromosome size (Lukhtanov and Dantchenko 2002b) and variation in number of chromosomes bearing ribosomal DNA clusters (Vershinina et al. 2015). These differences provide reliable characters for species delimitation, description and identification (de Lesse 1960, 1963; Lukhtanov and Dantchenko 2002a, b).

The P. (A.) damone species complex represents an exception. In this group divergence in several phylogenetic lineages was not accompanied by changes in karyotypes, and the chromosome number n = 66-67 is the synapomorphic character for the species of the group.

DNA-barcode clusters

The DNA-barcode clusters revealed in our study correspond well to traditionally recognized species and certain specific geographic areas (Figs 3, 4). Cluster 1 includes specimens from the Crimea in the west to Altai and Saur-Tarbagatai Mts in the east and corresponds to P. (A.) damone. Cluster 2 includes specimens from NE Kyrgyzstan, SE Kazakhstan and SW Mongolia and corresponds to P. (A.) juldusus + P. (A.) mediator. Cluster 3 includes specimens from western and southern Kyrgyzstan, southern Kazakhstan and Tajikistan and corresponds to P. (A.) iphigenides iphigenides + P. (A.) iphigenides melanius. Cluster 4 includes specimens from West Hissar in Uzbekistan and western Tajikistan and corresponds to P. (A.) iphigenides zarmitanus subsp. nov. which will be described below. Cluster 5 includes specimens from Karatau Mts in Kazakhstan and corresponds to P. (A.) karatavicus. Cluster 6 (Fig. 4) includes specimens from northeastern Iran to southeastern Kazakhstan and corresponds to P. (A.) phyllides.

Figure 3.

Distribution areas of the COI clusters revealed in this study. Cluster 1 corresponds to P. damone. Cluster 2 corresponds to P. juldusus + P. mediator. Cluster 3 corresponds to P. iphigenides (including P. iphigenides melanius). Cluster 4 corresponds to P. zarmitanus. Cluster 5 corresponds to P. karatavicus.

Cluster 6 (=P. phyllides) is sympatric with cluster 2 (=P. juldusus) in northern Kyrgyzstan and southeastern Kazakstan, with cluster 3 (=P. iphigenides iphigenides+P. iphigenides melanius) in Kyrgyzstan and Tajikistan, with cluster 4 (=P. iphigenides zarmitanus) in Uzbekistan and western Tajikistan, with cluster 5 (=P. karatavicus) in Karatau Mts in Kazakhstan (Eckweiler and Bozano 2016; our personal observations).

Figure 4.

Distribution area of P. phyllides (cluster 6).

Taxonomic interpretations

Clusters 1 (P. damone), 2 (P. juldusus + P. mediator) and 5 (P. karatavicus)

We follow previous research (Dantchenko 2000; Dantchenko and Churkin 2003, Lukhtanov et al. 2005) in interpreting clusters 1 (P. damone), 2 (P. juldusus and P. mediator) and 5 (P. karatavicus) (see Taxonomic conclusions below). P. (A.) mediator was described as a species which is intermediate between P. (A.) damone and P. (A.) juldusus, but more similar to P. (A.) juldusus due to specific white pubescence of the costal area of the forewings (Dantchenko and Churkin 2003). This conclusion is now supported by molecular data: on the phylogenetic tree it appears as a clade, which also includes P. (A.) juldusus kasachstanus, and as a sister clade to P. (A.) juldusus juldusus + P. (A.) juldusus kirgisorum.

Up to our knowledge there are no data on sympatry of P. (A.) mediator and P. (A.) damone in Mongolia as it was reported or supposed earlier (Bálint and Johnson 1987; Bálint 1989).

Cluster 3 (P. iphigenides iphigenides + P. iphigenides melanius)

Polyommatus (Agrodiaetus) iphigenides is highly polymorphic with regard to the black suffusion on the wing upperside and the marginal and submarginal part of the wing underside in males as well as the white streak on hindwings in both sexes. In extreme cases, the suffusion can be practically absent resembling the upperside in P. damone or may extend almost to the discal spot which is observed as a fixed feature in two other taxa, P. iphigenides melanius and P. juldusus kirgisorum. The white streak is also very variable from clear visibility to complete absence. The taxa P. (A.) samusi Korb, 2017 (syn. nov.) and P. (A.) melanius komarovi Korb, 2017 (syn. nov.) are mainly described on the base of such extreme forms of the same population. Therefore, we consider these taxa as junior subjective synonyms of P. (A.) iphigenides iphigenides.

Cluster 3 also includes the taxon described as Lycaena kindermanni var. Melania Staudinger, 1886. For a long time, due to lack of material it had been considered to be a melanized form of P. (A.) iphigenides iphigenides (e.g. Forster 1960). But in recent years it has been treated as a separate species P. (A.) melanius with a local, nearly dot-like distribution in the border area between southwestern Kyrgyzstan and eastern Tajikistan in the Kyzylsu/Surkhob River basin (Dantchenko 2000; Eckweiler and Bozano 2016). We found that DNA barcodes of P. (A.) iphigenides and P. (A.) melanius are identical or differ by non-fixed 1–2 nucleotide substitutions. The main feature of P. (A.) melanius, a wide dark marginal border on the fore- and hindwings, is quite stable for the diagnosis of the taxon; however, the tendency towards such a wide border is expressed in different populations of P. (A.) iphigenides, too. Therefore, this trait can be hardly considered a species-specific character. Here we argue that P. (A.) melanius is rather a subspecies P. (A.) iphigenides than a species. However, this is not a final conclusion. There is indirect evidence in favour of a possible species status of P. (A.) melanius, e.g. the distribution areas of P. (A.) iphigenides iphigenides and P. (A.) iphigenides melanius almost touch each other, and an intergradation zone would be expected between them. However, such a zone is still unknown, and specimens of P. (A.) iphigenides iphigenides and P. (A.) iphigenides melanius from very close localities are clearly differentiated. We suppose that genome-wide analysis may be useful to verify the taxonomic status of P. (A.) iphigenides melanius.

Cluster 4 (P. iphigenides zarmitanus)

Morphologically this group is close to P. ipigenides iphigenides, whereas with regard to mitochondrial DNA it is close to sympatric species P. phyllides which is morphologically very different. In our opinion, two alternative evolutionary scenarios can explain this pattern.

Scenario 1

The cluster 4 (P. iphigenides zarmitanus) and the lineage 6 (P. phyllides) are sister species which recently evolved from a common ancestor by means of sympatric speciation.

Scenario 2

Cluster 3 (P. iphigenides) and cluster 4 (P. iphigenides zarmitanus) are sister taxa evolved in allopatry; therefore, they share an ancestral type of the wing pattern and coloration, although differentiated with respect to DNA barcodes. The similarity between completely sympatric cluster 4 (P. iphigenides zarmitanus) and lineage 6 (P. phyllides) is a result of ancient mitochondrial introgression.

Analysis of multiple nuclear markers is required in order to distinguish between these two scenarios. Scenario 2 seems to be more probable since mitochondrial introgression is not a rare phenomenon in butterflies (e.g. Gompert 2008; Cong et al. 2017) and is also documented in the subgenus Polyommatus (Agrodiaetus) (Lukhtanov et al. 2015). Therefore, below we describe the new lineage discovered in West Hissar region as a subspecies of P. iphigenides.

Cluster 6 (P. phyllides)

There is no doubt that the cluster 6 (P. phyllides) is a distinct species, since it is a monophyletic lineage (Fig. 1), which is morphologically and ecologically differentiated (Dantchenko 2000, Eckweiler and Bozano 2016) and sympatric with P. (A.) iphigenides iphigenides, P. (A.) iphigenides melanius, P. (A.) iphigenides zarmitanus, P. (A.) karatavicus and P. (A.) juldusus.

New subspecies description

Polyommatus (Agrodiaetus) iphigenides zarmitanussubsp. nov.

Holotype

(Fig. 5a, b), male, BOLD process ID BPAL1393-12, field # CCDB-03030_F03, GenBank accession number MW186966; Uzbekistan, Samarqand Region, Nuratau Mts, near Zarmitan village, 40.40°N, 66.69°E, 1300 m, 11–13 June 1994, V. Lukhtanov leg., deposited in the Zoological Institute of the Russian Academy of Science (St. Petersburg).

Figure 5.

Males of Polyommatus (Agrodiaetus) iphigenides a, b upperside (a) and underside (b) of the holotype of P. (A.) iphigenides zarmitanus subsp. nov. c, d upperside (c) and underside (d) of P. (A.) iphigenides iphigenides, Tajikistan, Transalai Mts, Shibe village e, f upperside (e) and underside (f) of the Lectotype of P. (A.) iphigenides iphigenides, “Namangan”, in Museum für Naturkunde, Humboldt-Universität zu Berlin g, h upperside (g) and underside (h) of the Lectotype of P. (A.) iphigenides melanius, in Museum für Naturkunde, Humboldt-Universität zu Berlin. Scale Bars: 10 mm.

COI barcode sequence of the holotype

ACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGGACATCCCTAAGAATTTTAATCCGTATAGAATTGAGAACT CCTGGATCCTTAATTGGAGACGATCAAATTTATAATACTATTGTTACAGCCCATGCATTTATTATAATTTTTTTTATAGTTA TACCTATTATAATTGGGGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCACCTGATATAGCCTTCCCCCGATTAAA TAATATAAGATTCTGATTATTACCGCCATCATTAATACTACTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGA TGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATAGAGGATCATCTGTAGATTTAGCAATTTTCTCTCTTCATTTAG CAGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAACATACGGGTAAATAATTTATCATTTGATCA AATATCATTATTTATTTGAGCAGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACC ATATTATTAACAGATCGAAACCTTAATACCTCATTCTTTGACCCAGCTGGTGGGGGAGATCCAATTTTATATCAACATTTA.

Paratypes

39 males, 14 females: Uzbekistan, Samarqand Region, Nuratau Mts, near Zarmitan village, 40.40°N, 66.69°E, 1300 m, 11–13 June 1994, V. Lukhtanov leg. 2 males: Uzbekistan, Qashqadaryo Region (old spelling: Kashkadarya Region), Hissar Range (west), near Tamshush village, 38.98°N, 67.35°E, 1800 m, 18–20 June 1994, V. Lukhtanov leg. 20 males: Uzbekistan, Qashqadaryo Region (old spelling: Kashkadarya Region), Hissar Range (west), near Tamshush village, 38.98°N, 67.35°E, 1800 m, 5–7 July 1994, V. Lukhtanov leg. 11 males, 2 females: Uzbekistan, Surxondaryo Region (old spelling: Surkhandarya Region), Hissar Range (west), Sangardak, 38.55°N, 67.50°E, 1600 m, 2 July 1994, V. Lukhtanov leg. 60 males, 21 females: Uzbekistan, Samarqand Region, Zeravshansky Range, Aman-Kutan, 1800 m, 39.27°N, 66.90°E, 7 July 1994, V. Lukhtanov leg. 13 males: Tajikistan, Sughd Region, Zeravshansky Range, Padzhrud village, 39.37°N, 68.03°E, 1300 m, 17 males, 13 males, 10 June 1994. All above paratypes are deposited in the Zoological Institute of the Russian Academy of Science (St. Petersburg). 5 males: Uzbekistan, [Jizzakh region], Usmat vic., 1700 m, 30.06.1988, V. Tshikolovets leg., in State Darwin Museum, Moscow. 15 males: [Uzbekistan], Aman-Kutan near Samarqand, 20 June 1938, A. Tsvetaev leg., in State Darwin Museum, Moscow. 26 males, 1 female: [Tajikistan], Hisar-Alai, Zeravshansky Range, Farob, 2000 m, 4 July 1998, G.D. Samodurov leg., in State Darwin Museum, Moscow. 1 female: Tajikistan, West Hissar, Nofin lake, 2400, 17 July 1993, S. Churkin leg., in State Darwin Museum, Moscow. 32 males: [Uzbekistan], Aman-Kutan near Samarqand, 15–25 June 1938, A. Tsvetaev leg., in Zoological Museum Moscow University, Moscow (ZMMU). 7 males: [Uzbekistan], Aman-Kutan near Samarqand, 20–23 June 1938, G.Pashin leg., in ZMMU. 2 males: [Uzbekistan], Aman-Kutan near Samarqand, 27 July and 5 August 1937, A. G. Pashin leg., in ZMMU. 3 females: [Uzbekistan], Aman-Kutan near Samarqand, 15–26 June 1938, A. Tsvetaev leg., in ZMMU. 8 males: Tajikistan, West Hissar, Khazorchashma lake, 2800, 26 July 1993, S. Churkin leg.; 1 female: Tajikistan, West Hissar, Nofin lake, 2400, 17 July 1993, S. Churkin leg., in coll. Churkin (Reutov, Russia). 2 males, 1 female: Uzbekistan, West Hissar, Boysun Mts, Mochay, 1500 m, 26 June 1980, V. Tuzov leg., in coll. Tuzov (Moscow). 10 males, 1 female: [Uzbekistan], Aman-Kutan near Samarqand, 19–23 June 1938, A. Tsvetaev leg., in coll. Sochivko A. (Moscow). 10 males, 1 female: [Tajikistan], Hissar-Alai, Zeravshansky Range, Farob, 2000 m, 4 July 1998, L. Nikolaevsky leg., in coll. V. Kalinin, Moscow.

Description

Males. Forewing length 15–17 mm.

Upperside: Ground color bright glossy milky blue with narrow black marginal line, marginal part of forewings and hindwings dusted with black scales, discal strokes may be present or absent, veins darkened, costal area of the forewings white, hindwings with antemarginal spots, fringe white.

Underside: Forewing ground color light grey, submarginal row blurred, but clear visible; discoidal strokes black, bordered with white; postdiscal rows of black spots bordered with white, basal black spots absent; hindwing ground color light grey, basal area with strong greenish blue suffusion between wing root and basal spots; basal spots small, bordered with white, discal stroke less prominent than on forewings; postdiscal row of black spots bordered with white, submarginal and antemarginal marking strong and clear visible; submarginal row bordered distally with reddish lunules, more pronounced to anal end of row; white streak not contrasting, often hardly noticeable or absent at all, fringes pale grayish.

Genitalia. The male genitalia have a structure typical for other species of the subgenus Agrodiaetus (Coutsis 1986, Eckweiler and Bozano 2016).

Females. (Fig. 6a, b) Forewing length 15–17 mm.

Upperside: Ground color brown with slightly darker veins, discal strokes present, submarginal and antemarginal marking almost absent on fore wings and strong and clear visible on hindwings, antemarginal black spots on hindwings bordered with orange lunules, fringe whitish.

Underside: ground color and general design as in males but darker, brownish grey, greenish blue basal suffusion near invisible, white streak on hindwings clear visible, enlarged distally, fringe light greyish.

Figure 6.

Females of Polyommatus (Agrodiaetus) iphigenides a, b upperside (a) and underside (b) of the paratype of P. (A.) iphigenides zarmitanus subsp. nov. c, d upperside (c) and underside (d) of P. (A.) iphigenides iphigenides, Tajikistan, Transalai Mts, Shibe village. Scale Bars: 10 mm.

Diagnosis

The new subspecies is distinguished phenotypically from the most similar P. iphigenides iphigenides (Figs 5c–f, 6c, d) by the underside of the hind wing, which has a paler and less contrasting coloration. The white streak is also dim and weakly stands out against the background of the wing, is often reduced or absent. The same can be said about the basal greenish-blue suffusion: it is dim and weakly stands out against the background of the wing; its size, on average, is much smaller than that in P. iphigenides iphigenides. As a rule, it is limited by black dots of the basal row, while in P. iphigenides iphigenides it usually extends further in the distal direction, sometimes to spots of the discal row. This suffusion itself has a more greenish tint than that in P. iphigenides iphigenides (in the latter, it is more blue). The new species always has black dots of the basal row (although they are small), while in another species they are reduced.

The main differences between the species are still in the molecular characters. Polyommatus iphigenides zarmitanus can be distinguished from P. iphigenides iphigenides by using molecular markers from the COI gene. These mitochondrial diagnostic characters are in the following positions in the COI barcode region: adenine (A) in position 22, cytosine (C) in position 132, guanine (G) in position 180, cytosine (C) in position 286, guanine (G) in position 468, guanine (G) in position 468, and guanine (G) in position 627.

The new subspecies differs from sympatric (syntopic and synchronous) P. phyllides by milky blue (not greenish blue) wing upperside and white pubescence of the costal area of the forewings in males and by light grey color of the wing underside (P. phyllides has specific warm pinkish grey color of the wing underside). It also differs from P. phyllides by diagnostic nucleotide guanine (G) in position 627 of the COI barcode region.

Distribution area

(Fig. 7). Uzbekistan: West part of the Hissar Range, Zeravshan Mts, Nuratau Mts, Boysun (= Baisuntau) Mts. Tajikistan: west part of the Zeravshan valley and Zeravshansky Range, West Hisar Range.

Figure 7.

Distribution area of P. (A.) iphigenides zarmitanus. 1 is the type-locality, Zarmitan in Nuratau Mts. 2 is Padzhrud village in Zeravshansky Range. 3 is Aman-Kutan near Samarqand. 4 is Kitabsky Reserve in Hissar Range. 5 is Tamshush in Hissar Range. 6 is Sangardak in Hissar Range. 7 are Khazorchashma and Nofin lakes in Hissar Range. 8 is Mochay in Boysun Mts.

Habitat and biology

Stony steppe and dry meadows from 1200 up to 2800 m alt. Flight period from late May to first decade of August in a single generation. The new subspecies flies syntopically and synchronously with the second generation of P. (A.) phyllides, but on average about one decade earlier. Host plant is preliminary determined as Hedysarum sp. (Fabaceae).

Etymology

The name zarmitanus is an adjective of the masculine gender. This name originates from Zarmitan, the village in Uzbekistan.

Taxonomic conclusion

The discovered topology (Fig. 1) can be considered as a signal to taxonomic rearrangement within the group. However, since the volume of the studied material of these taxa is small, we prefer to leave the existing taxonomic hypotheses. Additionally, we assume that the hypothesis of the existence of a species called P. (A.). altaiensis with subspecies P. (A.) altaiensis altaiensis, P. (A.) altaiensis bogdoolensis Dantchenko et Lukhtanov, 1997, P. (A.). altaiensis mediator and P. (A.) altaiensis habievi Yakovlev, 2004 (Eckweiler and Bozano 2016) is speculative and not supported by significant morphological characters.

Based on the stated above, we propose the following taxonomic arrangement of the P. damone species complex:

P. (A.) damone (Eversmann, 1841)

P. (A.) damone pljushtchi (Lukhtanov et Budashkin, 1993)

P. (A.) damone tanais Dantchenko et Pljushtch, 1993

P. (A.) damone irinae Dantchenko, 1997

P. (A.) damone damone (Eversmann, 1841)

P. (A.) damone altaicus (Elwes, 1899) (= Lycaena damone var. sibirica Staudinger, 1899; = Agrodiaetus carmon altaiensis Forster, 1956)

P. (A.) damone walteri Dantchenko et Lukhtanov, 1993

P. (A.) damone bogdoolensis Dantchenko et Lukhtanov, 1997

P. (A.) damone fabiani Bálint, 1997

P. (A.) mediator Dantchenko et Churkin, 2003 (= Agrodiaetus mediator habievi Yakovlev, 2004)

P. (A.) juldusus (Staudinger, 1886) (= Lycaena damone var. duplicata A. Bang-Haas, 1910)

P. (A.) juldusus juldusus (Staudinger, 1886)

P. (A.) juldusus kirgisorum Lukhtanov et Dantchenko, 1994 (=P. hyrsyz Koçak et Kemal, 2001; = P. kirgisorum khamul Korb, 2009; = P. kirgisorum gorthaur Korb, 2009)

P. (A.) juldusus kasachstanus Lukhtanov et Dantchenko, 1994

P. (A.) juldusus rueckbeili Forster, 1960

P. (A.) juldusus tianchinensis Eckweiler, 2013

P. (A.) iphigenides (Staudinger, 1886)

P. (A.) iphigenides iphigenides (Staudinger, 1886) (= P. ishkashimicus alajanus Korb, 1997; = P. samusi Korb, 2017, syn. nov.; = P. melanius komarovi Korb, 2017, syn. nov.)

P. (A.) iphigenides melanius (Staudinger, 1886)

P. (A.) iphigenides zarmitanus subsp. nov.

P. (A.) karatavicus Lukhtanov, 1990

P. (A.) phyllides (Staudinger, 1886)

P. (A.) phyllides phyllides (Staudinger, 1886)

P. (A.) phyllides askhabadicus (Forster, 1960)

P. (A.) phyllides kentauensis Lukhtanov, 1990

P. (A.) phyllides urumbash Churkin et Zhdanko, 2008

Acknowledgements

We thank Martin Wiemers (Senckenberg Research Institute) and an anonymous reviewer for constructive criticism, comments and suggestions regarding the previous version of this article. We thank Wolfram Mey (Museum für Naturkunde, Humboldt-Universität zu Berlin), Pavel Bogdanov (State Darwin Museum, Moscow) and Andrey Sviridov (Zoological Museum of Moscow State University) for granting access to historical material of O. Staudinger, G. Pashin and A. Tsvetaev. We are very grateful to Zsolt Bálint (Hungarian Natural History Museum) for useful discussion. Further thanks are to Sergei Churkin, Vasily Tuzov, Andrey Sochivko and Valentin Kalinin (Moscow) for providing the opportunity to study the specimens from West Hissar. Our special gratitude is to Anastasia Gagarina (Zoological Institute RAS, St. Petersburg) for help in submitting the sequences to GenBank. Last but not least we express our keen appreciation to Faizullo Barotzada Radzhab and Sainimon Absalomov (Jirgatol, Tajikistan) for generous hospitality during our field work. The collection of material was performed in the frames of the state research project no. AAAA-A19-119020790106-0. The financial support for all chromosomal and molecular studies and all analysis was provided by the grant no. 19-14-00202 from the Russian Science Foundation to the Zoological Institute of the Russian Academy of Sciences.

References

  • Bálint Z (1989) Recently collected lycaenid butterflies of Mongolia (V) (Lep., Lycaenidae). Galathea 5: 101–112.
  • Bálint Z, Johnson K (1987) Reformation of the Polyommatus section with taxonomic and biogeographic overview (Lepidoptera, Lycaenidae, Polyommatini). Neue Entomologische Nachrichten 40: 1–68.
  • Cong Q, Shen J, Borek D, Robbins RK, Opler PA, Otwinowski Z, Grishin NV (2017) When COI barcodes deceive: complete genomes reveal introgression in hairstreaks. Proceedings of the Royal Society B – Biological Sciences 284: 20161735. https://doi.org/10.1098/rspb.2016.1735
  • Coutsis JG (1986) The blue butterflies of the genus Agrodiaetus Hübner (Lepidoptera, Lycaenidae): symptoms of taxonomic confusion. Nota Lepidopterologica 9: 159–169.
  • Dantchenko AV (1997) Notes on the biology and distribution of the damone and damocles species-complexes of the subgenus Polyommatus (Agrodiaetus) (Lepidoptera: Lycaenidae). Nachrichten des Entomologischen Vereins Apollo 16: 23–42.
  • Dantchenko AV (2000) Genus Agrodiaetus. In: Tuzov VK (Ed.) Guide to the butterflies of Russia and adjacent territories, Vol. 2. Sofia: Moscow, Pensoft, 196–214.
  • Dantchenko A, Churkin S (2003) A new species of the genus Polyommatus Latreille, 1804 from Mongolia (Lepidoptera, Lycaenidae). Neue Entomologische Nachrichten 54: 5–13.
  • Dantchenko A, Lukhtanov VA (1993) Zur Systematik und Verbreitung der Arten der Polyommatus (Agrodiaetus) damone-Gruppe (Lepidoptera, Lycaenidae) Südosteuropas und Südwestsibiriens. Atalanta 24(1/2): 75–83, 324–325.
  • de Lesse H (1960) Speciation et variation chromosomique chez les Lepidopteras Rhopaloceras. Annales des Sciences Naturelles Zoologie et Biologie Animale, 12e série 2: 1–223.
  • de Lesse H (1963) Variation chromosomique chez Agrodiaetus carmon H. S. et A. cyanea Stgr. Revue Française d’Entomologie 30: 177–181.
  • deWaard JR, Ivanova NV, Hajibabaei M, Hebert PDN (2008) Assembling DNA barcodes: analytical protocols. In: Martin CC (Ed.) Environmental Genomics, Methods in Molecular Biology. Humana Press, Totowa, New Jersey, 410: 275‒283. https://doi.org/10.1007/978-1-59745-548-0_15
  • Eckweiler W, Bozano GC (2016) Guide to the butterflies of the Palearctic region. Lycaenidae part IV. Milano, Omnes artes, 132 pp.
  • Forster W (1956) Bausteine zur Kenntnis der Gattung Agrodiaetus Scudd. (Lep. Lycaen) I. Zeitschrift der Wiener Entomologischen Gesellschaft 41: 42–61, 70–89, 118–127.
  • Forster W (1960) Bausteine zur Kenntnis der Gattung Agrodiaetus Scudd. (Lep. Lycaen) II. Zeitschrift der Wiener Entomologischen Gesellschaft 45: 105–142.
  • Gompert Z, Forister ML, Fordyce JA, Nice CC (2008) Widespread mito‐nuclear discordance with evidence for introgressive hybridization and selective sweeps in Lycaeides. Molecular Ecology 17: 5231–5244. https://doi.org/10.1111/j.1365-294X.2008.03988.x
  • Hajibabaei M, deWaard JR, Ivanova NV, Ratnasingham S, Dooph RT, Kirk SL, Mackie PM, Hebert PDN (2005) Critical factors for assembling a high volume of DNA barcodes. Philosophical Transactions of the Royal Society of London – Series B, Biological Sciences 360: 1959–1967. https://doi.org/10.1098/rstb.2005.1727
  • Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Kandul NP (1997) The karyology and the taxonomy of the blue butterflies of the genus Agrodiaetus Hübner [1822] from the Crimea (Lepidoptera: Lycaenidae). Atalanta 28: 111–119.
  • Kandul NP, Lukhtanov VA, Dantchenko AV, Coleman JWS, Sekercioglu CH, Haig D, Pierce NE (2004) Phylogeny of Agrodiaetus Hübner 1822 (Lepidoptera: Lycaenidae) Inferred from mtDNA Sequences of COI and COII and Nuclear Sequences of EF1-α: Karyotype Diversification and Species Radiation. Systematic Biology 53(2): 278–298. https://doi.org/10.1080/10635150490423692
  • Lukhtanov VA (1989) Karyotypes of some blue butterflies of the Agrodiaetus species groups. Annales Entomologici Fennici 55: 137–144.
  • Lukhtanov VA (2015) The blue butterfly Polyommatus (Plebicula) atlanticus (Lepidoptera, Lycaenidae) holds the record of the highest number of chromosomes in the non-polyploidy eukaryotic organisms. Comparative Cytogenetics 9(4): 683–690. https://doi.org/10.3897/CompCytogen.v9i4.5760
  • Lukhtanov VA, Dantchenko AV (2002a) Principles of highly ordered metaphase I bivalent arrangement in spermatocytes of Agrodiaetus (Lepidoptera). Chromosome Research 10(1): 5–20. https://doi.org/10.1023/A:1014249607796
  • Lukhtanov VA, Dantchenko AV (2002b) Descriptions of new taxa of the genus Agrodiaetus Hübner, [1822] based on karyotype investigation (Lepidoptera, Lycaenidae). Atalanta 33(1/2): 81–107, 224–225.
  • Lukhtanov VA, Dantchenko AV, Kandul NP (1997) Die Karyotypen von Polyommatus (Agrodiaetus) damone damone und P. (A.) damocles rossicus nebst einigen Problemen bei Agrodiaetus (Lepidoptera: Lycaenidae). Nachrichten des Entomologischen Vereins Apollo Supplement 16: 43–48.
  • Lukhtanov VA, Kandul NP, Plotkin JB, Dantchenko AV, Haig D, Pierce NE (2005) Reinforcement of pre-zygotic isolation and karyotype evolution in Agrodiaetus butterflies. Nature 436(7049): 385–389. https://doi.org/10.1038/nature03704
  • Lukhtanov VA, Vila R, Kandul NP (2006) Rearrangment of the Agrodiaetus dolus species group (Lepidoptera, Lycaenidae) using a new cytological approach and molecular data. Insect and Systematic and Evolution 37(3): 325–334. https://doi.org/10.1163/187631206788838563
  • Lukhtanov VA, Shapoval NA, Dantchenko AV (2008) Agrodiaetus shahkuhensis sp. n. (Lepidoptera, Lycaenidae), a cryptic species from Iran discovered by using molecular and chromosomal markers. Comparative Cytogenetics 2(2): 99–114.
  • Lukhtanov VA, Sourakov A, Zakharov EV, Hebert PDN (2009) DNA barcoding Central Asian butterflies: increasing geographical dimension does not significantly reduce the success of species identification. Molecular Ecology Resources 9: 1302–1310. https://doi.org/10.1111/j.1755-0998.2009.02577.x
  • Lukhtanov VA, Shapoval NA, Dantchenko AV (2014) Taxonomic position of several enigmatic Polyommatus (Agrodiaetus) species (Lepidoptera, Lycaenidae) from Central and Eastern Iran: insights from molecular and chromosomal data. Comparative Cytogenetics 8(4): 313–322. https://doi.org/10.3897/CompCytogen.v8i4.8939
  • Lukhtanov VA, Shapoval NA, Anokhin BA, Saifitdinova AF, Kuznetsova VG (2015) Homoploid hybrid speciation and genome evolution via chromosome sorting. Proceedings of the Royal Society B – Biological Sciences 282(1807): 20150157. https://doi.org/10.1098/rspb.2015.0157
  • Lukhtanov VA, Sourakov A, Zakharov EV (2016) DNA barcodes as a tool in biodiversity research: testing pre-existing taxonomic hypotheses in Delphic Apollo butterflies (Lepidoptera, Papilionidae). Systematics and Biodiversity 14(6): 599–613. https://doi.org/10.1080/14772000.2016.1203371
  • Przybyłowicz Ł, Lukhtanov V, Lachowska-Cierlik D (2014) Towards the understanding of the origin of the Polish remote population of Polyommatus (Agrodiaetus) ripartii (Lepidoptera: Lycaenidae) based on karyology and molecular phylogeny. Journal of Zoological Systematics and Evolutionary Research 52(1): 44–51. https://doi.org/10.1111/jzs.12040
  • Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA (2018) Posterior summarisation in Bayesian phylogenetics using Tracer 1.7. Systematic Biology 67: 901–904. https://doi.org/10.1093/sysbio/syy032
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Staudinger O (1899) Ueber die Arten and Formen der Lycaena damon-Gruppe. Deutsche Entomologische Zeitschrift Iris 12: 137–155.
  • Vershinina AO, Lukhtanov VA (2010) Geographical distribution of the cryptic species Agrodiaetus alcestis alcestis, A. alcestis karacetinae and A. demavendi (Lepidoptera, Lycaenidae) revealed by cytogenetic analysis. Comparative Cytogenetics 4(1): 1–11. https://doi.org/10.3897/compcytogen.v4i1.21
  • Vershinina AO, Anokhin BA, Lukhtanov VA (2015) Ribosomal DNA clusters and telomeric (TTAGG)n repeats in blue butterflies (Lepidoptera, Lycaenidae) with low and high chromosome numbers. Comparative Cytogenetics 9(2): 161–171. https://doi.org/10.3897/CompCytogen.v9i2.4715
  • Vishnevskaya MS, Saifitdinova AF, Lukhtanov VA (2016) Karyosystematics and molecular taxonomy of the anomalous blue butterflies (Lepidoptera, Lycaenidae) from the Balkan Peninsula. Comparative Cytogenetics 10(5): 1–85. https://doi.org/10.3897/CompCytogen.v10i5.10944
  • Vodolazhsky D, Stradomsky B (2012) Comparative genital and molecular genetic analysis of blue butterflies (Lepidoptera: Lycaenidae) of Rostov-on-Don area. In: Troitsky AV, Rusin LY, Aleoshin VV (Eds) Molecular Phylogenetics. Moscow, Torus Press, 70–71.
  • Vodolazhsky DI, Yakovlev R, Stradomsky B (2011) Study of taxonomic status of some specimens of subgenus Agrodiaetus (Lepidoptera: Lycaenidae: Polyommatus) from Western Mongolia based on mtDNA markers. Caucasian Entomological Bulletin 7(1): 81–82. https://doi.org/10.23885/1814-3326-2011-7-1-81-82
  • Wiemers M (2003) Chromosome Differentiation and the Radiation of the Butterfly subgenus Agrodiaetus (Lepidoptera: Lycaenidae: Polyommatus) a Molecular Phylogenetic Approach. PhD Thesis. University of Bonn, Bonn, 203 pp. http://hss.ulb.uni-bonn.de/2003/0278/0278.htm