Print
Cloning and physical localization of male-biased repetitive DNA sequences in Spinacia oleracea (Amaranthaceae)
expand article infoJian Zhou, Shaojing Wang, Li'ang Yu§, Ning Li, Shufen Li, Yulan Zhang, Ruiyun Qin, Wujun Gao, Chuanliang Deng
‡ Henan Normal University, Xinxiang, China
§ University of Illinois at Urbana-Champaign, Urbana, United States of America
Open Access

Abstract

Spinach (Spinacia oleracea Linnaeus, 1753) is an ideal material for studying molecular mechanisms of early-stage sex chromosome evolution in dioecious plants. Degenerate oligonucleotide-primed polymerase chain reaction (DOP-PCR) technique facilitates the retrotransposon-relevant studies by enriching specific repetitive DNA sequences from a micro-dissected single chromosome. We conducted genomic subtractive hybridization to screen sex-biased DNA sequences by using the DOP-PCR amplification products of micro-dissected spinach Y chromosome. The screening yielded 55 male-biased DNA sequences with 30 576 bp in length, of which, 32 DNA sequences (12 049 bp) contained repeat DNA sequences, including LTR/Copia, LTR/Gypsy, simple repeats, and DNA/CMC-EnSpm. Among these repetitive DNA sequences, four DNA sequences that contained a fragment of Ty3-gypsy retrotransposons (SP73, SP75, SP76, and SP77) were selected as fluorescence probes to hybridization on male and female spinach karyotypes. Fluorescence in situ hybridization (FISH) signals of SP73 and SP75 were captured mostly on the centromeres and their surrounding area for each homolog. Hybridization signals primarily appeared near the putative centromeres for each homologous chromosome pair by using SP76 and SP77 probes for FISH, and sporadic signals existed on the long arms. Results can be served as a basis to study the function of repetitive DNA sequences in sex chromosome evolution in spinach.

Keywords

FISH, Genomic subtraction hybridization, Retrotransposon, Sex chromosome evolution, Spinach

Introduction

Sex chromosomes evolved from autosomes by stages; the key event in the evolution of sex chromosomes includes the emergence of sex-determining genes, recombination suppression, accumulation of repetitive sequences, degeneration of Y chromosome, and dosage compensation effect of X chromosome (Abbott et al. 2017). Sex chromosomes in mammals are mostly ancient, but sex chromosomes in plants, insects and some fishes have recently evolved. In all evolutionary steps, recombinant suppression is a key step in the evolution of sex chromosomes. The ceasing of recombination avoids the occurrence of progeny sterilization or hermaphroditism among progenies. In early-stage sex chromosome evolution, the recombination of male-specific regions on the Y chromosome is reduced or restricted (Akagi et al. 2014). The size of the recombination suppression region and differences of size between X/Y or Z/W chromosomes generally reflect the stage of sex chromosome evolution. Homomorphic chromosomes are generally considered to be relatively young sex chromosomes, and their non-recombination regions are commonly very small. For example, asparagus (Asparagus officinalis Linnaeus, 1753) has a very young pair of sex chromosomes and very small male-specific regions (Harkess et al. 2017). Papaya (Carica papaya Linnaeus, 1753) also has homomorphic sex chromosomes with larger sex-specific regions than asparagus. Analysis of high-density linkage map of papaya revealed that 225 out of the 347 markers co-segregated with sex phenotype. This finding revealed the severe recombination suppression around the sex-determining site (Ma et al. 2004). Spinach (S. oleracea L., 2n = 12) is a diploid dioecious leafy vegetable with a pair of homomorphic sex chromosomes (Arumuganathan et al. 1991; Xu et al. 2017). In spinach, a Y-chromosomal region around the male-determining locus does not recombine with the counterpart region on the X chromosome (Takahata et al. 2016; Kudoh et al. 2018).

Repetitive DNA sequences, primarily transposons, retrotransposons (RTs), and tandem repeats (satellite DNA, small satellite DNA, and microsatellite DNA sequences), make up the majority of all the nuclear DNA in most eukaryotic genomes (Biscotti et al. 2015). These sequences used to be called garbage sequences, but their substantial roles in a variety of biological processes, including gene expression, transcriptional regulation, chromosome structure construction, have been recently discovered. Their functions and evolution are popular research topics (Mehrotra et al. 2014; Cioffi et al. 2015). Accumulation of repetitive sequences is among the most common features of the sex chromosomes of dioecious species. A great portion of repetitive sequences has been identified from the sex chromosomes of humans (Erlandsson et al. 2000), mammals (Dechaud et al. 2019), fish (Faber-Hammond et al. 2015), birds (Zhou et al. 2014), and insects (Bachtrog et al. 2003). In flowering plants, highly repetitive regions were distributed on the sex chromosomes of dioecious plants with heteromorphic sex chromosomes, such as Silene latifolia Poire, 1789 and Rumex acetosa (Linnaeus, 1753) (Hobza et al. 2017), similar to some dioecious plants with younger sex chromosomes. Papaya is a model species for studying early-stage sex chromosomes (Ming et al. 2008). The Y chromosome contains a small male-specific (MSY, 8.1 Mb, only 13% of the entire Y chromosome) (Vanburen et al. 2015). Studies have shown the enriched repetitive DNA sequences in this region (Wang et al. 2012). Further studies showed that repetitive DNA sequences accounted for approximately 77% of hermaphrodite-specific region in the Y chromosome (HSY), 79.2% of MSY, and 67.2% on the X-counterpart, the values of which were significantly higher than the ratio of repeat sequences in the entire genome (51%) (Yu et al. 2007; Na et al. 2014). The types of transposons in the HSY region, including Ty1-Copia and Ty3-Gypsy, are primarily RTs. The expansion of the sex-determining region was proposed to be related to the accumulation of Ty3-gypsy RTs (Na et al. 2014). BAC sequencing revealed that the Y-chromosome region around the male-determining locus in spinach contains a large amount of repetitive elements, most of which are novel Ty1-copia-like and its derivative elements (Kudoh et al. 2018). However, the BAC clone sequences account for only a part of the sex-linked non-recombining region. Further experiments are needed to determine the size of the sex-linked region in spinach.

Genomic subtraction is used for isolating DNA that is absent in deletion mutants. The method removes the sequences present in the wild-type (tester DNA) and the deletion mutant genomes (driver DNA) from wild-type DNA featured by simple, rapid, sensitive, and economic means. This technique is widely applied in the separation and identification of gene rearrangement and in the preparation of polymorphism loci probe (Straus et al. 1990; Hou et al. 1995; Asalone et al. 2019). However, whether the technique can be used to screen sex chromosome-specific DNA sequences has not been reported.

In this study, the X and Y chromosome of spinach were successfully isolated and amplified by degenerated-oligonucleotide-primed polymerase chain reaction (DOP-PCR) (Deng et al. 2013). Single chromosome DOP-PCR amplified products tend to enrich chromosome-specific DNA repeat sequences (Zhou et al. 2007). Then, using X chromosome DOP-PCR amplified products as the driver DNA and Y chromosome DOP-PCR amplified products as the tester DNA, the enriched repetitive DNA sequences on the Y chromosome were obtained by genomic subtraction hybridization. Our study provided a new approach for exploring enriched DNA repetitive sequences from spinach Y chromosome.

Material and methods

Plant materials

The seeds of spinach (S. oleracea Linnaeus, 1753, cv. Japan) were planted in the garden field of Henan Normal University under natural conditions. Genomic DNA from each male and female spinach was extracted from young leaves using the traditional cetyltrimethylammonium bromide method (Rogers et al. 1989).

Microdissection of X and Y chromosome in spinach

The X/Y chromosome is the largest submetacentric chromosome (Ellis et al. 1960; Deng et al. 2013). The microdissection of the largest chromosome in spinach was carried out according to the procedures described by Deng et al. (2013). Initially, the largest chromosome in spinach was identified based on its size and was microdissected using a glass needle that was fixed to the arm of a Leitz micro-operation instrument on an inverted phase-contrast microscope (Olympus 1 M, Japan). Ten chromosomes were isolated. The microdissected chromosome was collected into an Eppendorf tube (0.2 mL) and separately digested with proteinase K buffer at 0.5 mg/mL (Roche, Indianapolis) in 1× Taq polymerase buffer (Promega, Madison). The isolated chromosomal DNA was incubated in a proteinase K solution at 37 °C for 2 h. Proteinase K was then inactivated at 90 °C for 10 min. Then, the chromosome DNA was amplified by DOP-PCR in a PTC-200 thermocycler (MJ Research, Watertown, MA, USA). To obtain high-concentration DNA products for genomic subtraction library construction, the DOP-PCR products were amplified from X and Y chromosome by two rounds of recursive enrichment based on previous studies (primer sequence: CCGACTCGAGNNNNNNATGTGG) (Deng et al. 2013).

Construction of Y chromosome genomic subtraction library

The modified DOP-PCR primer that contains BamH I digestion site (modified primer sequence: CGGAGGATCCNNNNNNATGTGG), was used to amplify the products from the second round spinach Y chromosome DOP-PCR amplification. DOP-PCR amplification was performed in 50 μL reaction volume containing 1 × PCR buffer, 1.5 mmol/L dNTP Mixture (Transgene, Beijing, China), 2.5 U Taq polymerase (Takara, Bejing, China), 100 ng template DNA, and 0.2 μM primer. The amplification was performed by initial denaturation at 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 1 min, annealing temperature 55 °C for 90 s, extension at 72 °C for 3 min, and a final extension at 72 °C for 10 min. Then, the concentration of the amplified DOP-PCR products was quantified, followed by enzyme digestion in 25.0 μL volume containing 2 × K buffer and 20 000 U BamH I (Takara, Beijing, China) at 37 °C for 3 h in a metal bath for further quantification and quality control.

As described from Y chromosome amplification, the modified DOP-PCR primer was used to amplify the second round DOP-PCR amplification products of spinach X chromosome along with the quality control and quantification of the products. Finally, the amplified products from both X and Y chromosomes were purified using Takara MiniBEST DNA Fragment Purification Kit Ver.4.0 (Takara, Beijing, China).

The DOP-PCR amplified products from the libraries of X (Driver DNA) and Y (Tester DNA) chromosomes were mixed in a 100:1 ratio for subsequent hybridizations. The mixed DOP-PCR amplified products were treated by water bath at 99 °C for 10 min, mixed with 4 mL of PERT (8% phenol, 1.25 M sodium perchlorate, and 0.12 M disodium hydrogen phosphate dissolved in 1000 mL of distilled water) for 72 h, annealed at 25 °C and at 100 rpm on the shaking table for 72 h (shaking for 8 h and stopping for 8 h), and then placed on the shaking table overnight. After 72 h of annealing, the hybridization solution was purified by suction filtration with a syringe and an organic filter. It was extracted twice with chloroform:isoamyl alcohol at 24:1, centrifuged at 12 000 rpm for 5 min, precipitated by 1% volume of sodium acetate and 2.5 volumes of absolute ethanol at -20 °C overnight, centrifuged at 10 000 rpm for 10 min, washed twice with 70% absolute ethanol, dissolved in 800 μL sterile ddH2O, and transferred into a 1.5 mL centrifuge tube. Then, the mass of the hybridization solution was quantified by microspectrophotometer for further steps.

Enzyme digestion, purification, dephosphorylation, and re-purification of the vector were conducted.

A mixture of 1.0 μL of PUC119, 2.0 μL of 10 × K buffer, 2.0 μL of BamH I, and 15 μL ddH2O were quantified into 20.0 μL for 3 h digestion in a 30 °C water bath. Then, purification was performed according to Takara MiniBEST DNA Fragment Purification Kit Ver. 4.0 (Takara, Beijing, China). The reaction mixture was placed in a 0.2 mL centrifuge tube containing 40.0 μL (1–20 pmol) vector DNA, 5.0 μL 10 × K alkaline phosphatase buffer, and 1.0 μL CIAP, and adjusted to 50 μL. The reaction was conducted in a metal bath at 37 °C for 15 min, and then at 50 °C for 15 min for dephosphorylation, purification, and mass quantification.

Cloning of DNA subtraction library

Gradient design was carried out according to the ratio between the hybrid liquid and the vector, after which the optimized reaction mixture was placed in the microcentrifuge tube containing 1.5 μL PUC119 (Takara Code: 3319), 0.1 µL T4 DNA ligase (Takara Code: 2011A), and 2.0 µL 10 × buffer at contents up to 20 µL. The reaction was conducted in the metal bath at 16 °C for 5 h. The ligation products were transformed into competent cells, screened according to blue and white spots, and amplified by colony PCR using universal primer M13 (CGCCAGGGTTTTCCCAGTCACGAC).

Screening and identification of DNA subtractive library

The selected recombinant plasmids were identified using the spinach female and male genomic DNAs as probes labeled with DIG (Roche: 11277065910) by dot hybridization method. Basically, the subtractive DNA libraries with male-specific DNA sequences were hybridized and formed colonies on films. These colonies were selected for further Sanger sequencing.

Screening of repetitive DNA sequences

On the basis of the results of dot-blot hybridization, the male-hybridized colonies (PCR-amplified products derived from bacterial solution with more than 250 bp) were selected for Sanger sequencing at Shanghai Invitrogen Biotechnology Co., Ltd. The sequencing results were analyzed by BLASTn and RepeatMasker (http://www.repeatmasker.org/). Initially, sequencing products were blasted against the spinach reference genome (http://www.spinachbase.org/cgi-bin/spinach/index.cgi) with a cutoff of 90% similarity and E-value 1e-10 to prevent the contamination of the DNA from other organisms. Sequences with no hits were deleted. Then, the DNA sequences were aligned to RepeatMask libraries to classify the type of repeats. Ultimately, the DNA sequences were annotated using BLASTn against the NCBI nucleotide database. Based on the sequencing results, primers for each group of repetitive DNA sequences were designed by Oligo7 for PCR amplification (Suppl. material 1: Table S1). Amplification of those repetitive DNA was performed in a 20 μL reaction setting, which included 1 × PCR buffer, 0.75 mM dNTP Mixture, 1 U Taq polymerase (Takara, Bejing, China), 100 ng template DNA, and 0.1 μM primer. The reaction was carried out using the following cycle conditions: initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing temperature 55 °C for 45 s, extension at 72 °C for 1 min, and a final extension at 72 °C for 10 min. PCR products with a single amplified band were purified for fluorescent probe labeling.

Chromosome localization of repeat DNA sequences

The spinach seeds were initially soaked in a moisturized and low-temperature (4 °C) environment overnight. Then, the seeds were placed in a constant temperature incubator at 25 °C in the dark. The seeds with approximate 1 cm root length were placed in a 1.5 mL centrifugal tube for nitrous oxide pretreatment. Subsequently, the roots were fixed in 90% glacial acetic acid for 10 min and finally stored in the refrigerator at -20 °C in 70% ethanol. Each selected tissue was rinsed by distilled water for 10 min, after which it underwent dissection and digestion using a solution containing 1% pectolyase Y23 (Yakult Pharmaceutical, Tokyo) and 2% cellulose Onozuka R-10 (Yakult Pharmaceutical, Tokyo) for 1.5 h at 37 °C (one section per tube with 20 µL of the enzyme solution). The abovementioned treated root sections were carefully split into individual cells by using needles and by intensive vortexing at room temperature along with soaking in 100% ethanol. Furthermore, the cells were collected from the bottom of the tube by centrifugation and re-suspended in an acetic acid ethanol solution (9:1 dilution). Finally, the cell suspension was dropped onto glass slides in a box lined with wet paper towels for observation.

Then, 45S rDNA (the probe was donated by Fangpu Han, a researcher from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) was labeled using Alexa fluor-488-dUTP (green), and the male-specific bands were labeled using Texas-red-dCTP (red) with the nick translation method based on previous protocols (Birchler et al. 2008). The labeled probes were placed in a refrigerator with light prevention at -20 °C.

Fluorescence in situ hybridization (FISH) between spinach chromosomes at metaphase and DNA probes derived from each repetitive sequence was performed according to the method described in previous studies (Gao et al. 2011). Selected chromosome plates during the metaphase-stage for hybridization were placed into the ultraviolet crosslinker for 2 min with 0.125 J. A probe solution containing in 2 × SSC and 1 × TE was added to the slides. After denaturation in boiling water for 5 min, the slides with probe were incubated at 55 °C in a humid chamber for 8–12 h. After hybridization, the slides were washed in 2 × SSC and mounted on Vectashield mounting medium containing 1.5 μg/ml 4ʹ,6-diamidino-2-phenylindole (Vector Laboratories, Burlingame, USA). The FISH images were captured with an ANDOR CCD under an Olympus BX63 fluorescence microscope. The images were processed by Adobe Photoshop 7.0.

Results

Preparation of Tester DNA and Driver DNA

The amplified products from the X/Y chromosome were identified using a male-specific marker T11A (Onodera et al. 2011). Two X chromosomes and three Y chromosomes were successfully microdissected and amplified (Suppl. material 1: Fig. S1). The major Y chromosome DNA products amplified from DOP-PCR ranged from 200 bp to 1500 bp, and the DNA products of around 500 bp were mostly enriched (Fig. 1A). The majority of the X-chromosome DNA products amplified from DOP-PCR were enriched from 200 bp to 1500 bp. DNA products exhibited an even distribution among different sizes (Fig. 1B).

Figure 1.

Gel electrophoresis results of spinach Y (A) /X (B) chromosome DOP-PCR products using modified primer Lane M: Trans 2K plus DNA Marker; Lane 1–8(A): spinach Y chromosome second round DOP-PCR products as template using modified primer; Lane 1–8(B): spinach X chromosome second round DOP-PCR products as template using modified primer

Cloning and screening DNA genomic subtractive library

From the subtractive library, 2700 single colonies were obtained, among which 480 single colonies with lengths between 250 and 1500 bp were randomly selected for PCR amplification (Suppl. material 1: Fig. S2). To identify Y-specific DNA, the hybridization of spinach female/male genomic DNA with DNA sequences from subtractive library was performed. Unique hybridization between male spinach and DNA could be potentially from Y chromosome. Fifty-five Y chromosome-specific recombinant plasmids in spinach were identified by dot blot hybridization (Suppl. material 1: Fig. S3).

Screening male-biased repetitive DNA sequences

Sanger sequencing of the 55 selected DNA sequences yielded a total of 30, 576 bp of product, ranging from 248 bp to 1, 354 bp in length (MN830920MN830942, MN810356MN810387). A total of 12, 049 bp of DNA products were identified as repeat sequences using RepeatMasker softerware (http://www.repeatmasker.org/), which accounted for 39.4% of the total sequences. Thirty-two of the 55 DNA sequences contained repeat DNA sequences, including LTR/Copia, LTR/Gypsy, simple repeats and DNA/CMC-EnSpm (Suppl. material 1: Table S2). The sequence alignment of these 55 DNA sequences against the NCBI database (nr database) through BLASTn with default settings generated 55 significant hits. Those hits included spinach BAC clones, uncharacterized mRNA, and the transcription factor MYB80 (LOC110782202) of spinach from previous annotations and BAC libraries (S. oleracea L.) (Table 1).

Table 1.

BLAST search for spinach male-biased DNA fragments.

ID Accession number Size Description Query Cover E Value Per. Ident
SP1-3 MN830920 661 PREDICTED: Spinacia oleracea uncharacterized LOC110790287 (LOC110790287), transcript variant X4, ncRNA 96% 0 94.25%
SP1-71 MN830921 326 Select seq AP017640.1 Spinacia oleracea DNA, BAC clone: 009-126-13E-1, strain: 03-009, complete sequence 96% 3.00E-162 100.00%
SP1-86 MN810356 293 Select seq AP017641.1 Spinacia oleracea DNA, BAC clone: 009-160-1L-1, strain: 03-009, complete sequence 93% 2.00E-103 92.03%
SP1-89 MN810357 294 Select seq AP017637.1 Spinacia oleracea DNA, BAC clone: 009-26-14K-1, strain: 03-009, complete sequence 93% 2.00E-137 99.28%
SP2-26 MN810358 248 PREDICTED: Spinacia oleracea uncharacterized LOC110800978 (LOC110800978), mRNA 94% 1.00E-109 97.87%
SP3-4 MN810359 270 Select seq XM_021992625.1 PREDICTED: Spinacia oleracea uncharacterized LOC110787992 (LOC110787992), mRNA 98% 1.00E-79 87.41%
SP3-8 MN810360 261 Spinacia oleracea mitochondrion, complete genome 96% 3.00E-116 97.23%
SP3-36 MN830922 334 PREDICTED: Spinacia oleracea uncharacterized LOC110799754 (LOC110799754), mRNA 96% 1.00E-160 99.07%
SP3-88 MN830923 293 Spinacia oleracea DNA, BAC clone: 009-26-14K-1, strain: 03-009, complete sequence 68% 3.00E-67 91.04%
SP4-1 MN810361 433 Select seq XM_022007996.1 PREDICTED: Spinacia oleracea uncharacterized LOC110802566 (LOC110802566), mRNA 99% 6.00E-168 91.88%
SP4-2 MN810362 432 PREDICTED: Spinacia oleracea uncharacterized LOC110791229 (LOC110791229), mRNA 99% 0 95.82%
SP4-3 MN810363 423 PREDICTED: Spinacia oleracea uncharacterized LOC110802566 (LOC110802566), mRNA 96% 5.00E-179 94.51%
SP4-4 MN810364 426 Select seq XM_022001236.1 PREDICTED: Spinacia oleracea uncharacterized LOC110796204 (LOC110796204), mRNA 98% 0 94.41%
SP4-7 MN810365 432 PREDICTED: Spinacia oleracea uncharacterized LOC110802566 (LOC110802566), mRNA 98% 0 96.49%
SP4-8 MN810366 433 PREDICTED: Spinacia oleracea uncharacterized LOC110802566 (LOC110802566), mRNA 98% 0 96.73%
SP4-10 MN810367 432 Select seq XM_022007996.1 PREDICTED: Spinacia oleracea uncharacterized LOC110802566 (LOC110802566), mRNA 98% 0 96.02%
SP4-11 MN810368 423 PREDICTED: Spinacia oleracea uncharacterized LOC110802566 (LOC110802566), mRNA 98% 8.00E-177 93.68%
SP4-38 MN810369 293 Spinacia oleracea DNA, BAC clone: 009-123-11N-1, strain: 03-009, complete sequence 97% 1.00E-135 97.90%
SP4-48 MN830924 575 Select seq AP017641.1 Spinacia oleracea DNA, BAC clone: 009-160-1L-1, strain: 03-009, complete sequence 36% 2.00E-61 88.78%
SP4-53 MN830925 262 PREDICTED: Spinacia oleracea probable methyltransferase PMT15 (LOC110782476), mRNA 31% 2.00E-29 97.59%
SP5-1 MN810370 410 Select seq AP017639.1 Spinacia oleracea DNA, BAC clone: 009-123-11N-1, strain: 03-009, complete sequence 49% 2.00E-87 96.53%
SP5-2 MN830926 365 Select seq AP017641.1 Spinacia oleracea DNA, BAC clone: 009-160-1L-1, strain: 03-009, complete sequence 56% 1.00E-94 97.61%
SP5-3 MN830927 365 Spinacia oleracea DNA, BAC clone: 009-160-1L-1, strain: 03-009, complete sequence 57% 2.00E-93 97.14%
SP5-4 MN830928 356 Select seq AP017639.1 Spinacia oleracea DNA, BAC clone: 009-123-11N-1, strain: 03-009, complete sequence 56% 4.00E-55 87.13%
SP5-5 MN830929 534 Spinacia oleracea DNA, BAC clone: 009-126-13E-1, strain: 03-009, complete sequence 37% 7.00E-88 97.46%
SP5-9 MN830930 430 Select seq XM_022005381.1 PREDICTED: Spinacia oleracea uncharacterized LOC110800092 (LOC110800092), mRNA 51% 9.00E-92 95.05%
SP5-10 MN810371 409 Spinacia oleracea DNA, BAC clone: 009-123-11N-1, strain: 03-009, complete sequence 50% 3.00E-86 95.63%
SP5-11 MN810372 485 Spinacia oleracea DNA, BAC clone: 009-126-13E-1, strain: 03-009, complete sequence 42% 4.00E-90 97.97%
SP5-12 MN830931 326 Select seq AP017640.1 Spinacia oleracea DNA, BAC clone: 009-126-13E-1, strain: 03-009, complete sequence 96% 1.00E-161 100.00%
SP5-48 MN830932 277 Select seq AP017638.1 Spinacia oleracea DNA, BAC clone: 009-41-10L-1, strain: 03-009, complete sequence 94% 1.00E-75 87.17%
SP6-20 MN810373 573 Chain A, Cryo-EM structure of the spinach chloroplast ribosome reveals the location of plastid-specific ribosomal proteins and extensions 92% 6.00E-171 87.52%
SP7-3 MN810374 549 Select seq XM_021994667.1 PREDICTED: Spinacia oleracea uncharacterized LOC110789945 (LOC110789945), mRNA 79% 6.00E-133 86.73%
SP7-4 MN830933 504 PREDICTED: Spinacia oleracea transcription factor MYB80 (LOC110782202), mRNA 95% 0 98.96%
SP7-5 MN830934 587 Spinacia oleracea mitochondrion, complete genome 94% 0 98.74%
SP7-7 MN810375 536 PREDICTED: Spinacia oleracea uncharacterized LOC110777888 (LOC110777888), mRNA 53% 3.00E-116 93.73%
SP7-9 MN830935 504 Select seq XM_021986329.1 PREDICTED: Spinacia oleracea transcription factor MYB80 (LOC110782202), mRNA 93% 0 98.94%
SP7-10 MN810376 536 PREDICTED: Spinacia oleracea uncharacterized LOC110783205 (LOC110783205), mRNA 53% 9.00E-107 91.64%
SP7-11 MN830936 563 Select seq XM_021982478.1 PREDICTED: Spinacia oleracea pentatricopeptide repeat-containing protein At5g02860 (LOC110777897), mRNA 94% 0 99.06%
SP10-9 MN810377 790 Select seq XM_022003128.1 PREDICTED: Spinacia oleracea uncharacterized LOC110797998 (LOC110797998), mRNA 98% 0 84.22%
SP13-1 MN810378 267 Select seq XM_021992625.1 PREDICTED: Spinacia oleracea uncharacterized LOC110787992 (LOC110787992), mRNA 97% 2.00E-83 88.97%
SP13-2 MN810379 267 PREDICTED: Spinacia oleracea uncharacterized LOC110787992 (LOC110787992), mRNA 97% 2.00E-73 86.69%
SP17-1 MN810380 715 PREDICTED: Spinacia oleracea uncharacterized LOC110799950 (LOC110799950), mRNA 91% 0 91.10%
SP17-2 MN830937 1128 Select seq AP017639.1 Spinacia oleracea DNA, BAC clone: 009-123-11N-1, strain: 03-009, complete sequence 98% 0 93.99%
SP51-1 MN830938 758 PREDICTED: Spinacia oleracea tudor domain-containing protein 3 (LOC110774971), transcript variant X2, mRNA 51% 6.00E-178 99.71%
SP51-2 MN830939 766 PREDICTED: Spinacia oleracea tudor domain-containing protein 3 (LOC110774971), transcript variant X2, mRNA 45% 1.00E-179 100.00%
SP51-3 MN830940 758 PREDICTED: Spinacia oleracea tudor domain-containing protein 3 (LOC110774971), transcript variant X2, mRNA 51% 1.00E-179 100.00%
SP52-1 MN830941 644 Select seq AP017637.1 Spinacia oleracea DNA, BAC clone: 009-26-14K-1, strain: 03-009, complete sequence 42% 5.00E-79 87.73%
SP52-3 MN830942 638 Spinacia oleracea DNA, BAC clone: 009-26-14K-1, strain: 03-009, complete sequence 42% 5.00E-69 85.87%
SP55-1 MN810381 1001 Select seq AP017640.1 Spinacia oleracea DNA, BAC clone: 009-126-13E-1, strain: 03-009, complete sequence 93% 0 84.31%
SP55-3 MN810382 1001 PREDICTED: Spinacia oleracea uncharacterized LOC110802605 (LOC110802605), mRNA 50% 0 99.28%
SP55-4 MN810383 1001 PREDICTED: Spinacia oleracea uncharacterized LOC110802605 (LOC110802605), mRNA 53% 0 99.78%
SP73 MN810384 1318 Select seq AP017638.1 Spinacia oleracea DNA, BAC clone: 009-41-10L-1, strain: 03-009, complete sequence 100% 0 99.85%
SP75 MN810385 1354 Spinacia oleracea DNA, BAC clone: 009-41-10L-1, strain: 03-009, complete sequence 100% 0 99.93%
SP76 MN810386 1163 PREDICTED: Spinacia oleracea uncharacterized LOC110779482 (LOC110779482), partial mRNA 45% 3.00E-152 85.66%
sp77 MN810387 1154 PREDICTED: Spinacia oleracea uncharacterized LOC110779482 (LOC110779482), partial mRNA 45% 3.00E-147 85.23%

Chromosome localization of repetitive DNA sequences

Using the 32 DNA sequences that contained repeat DNA sequences as probes, we tried to identify the distribution of fluorescence signals on the Y chromosome. However, no fluorescence signals were found on the chromosomes using four simple repeats (SP5-1, SP55-1, SP55-3 and SP55-4) and two DNA/CMC-EnSpm DNA sequences (SP55-3 and SP55-4). When four LTR/Copia DNA sequences (SP3-4, SP3-8, SP17-1 and SP1-86) were selected to be used as probes, the signals showed a dispersed distribution in all chromosomes (Suppl. material 1: Figure S4). Four DNA sequences (SP73, SP75, SP76, and SP77) containing Ty3-gypsy family RTs were selected as probes for FISH (Suppl. material 1: Table S2).

Four pairs of primers were generated according to the DNA sequences SP73, SP75, SP76, and SP77 (Suppl. material 1: Table S1). PCR and gel electrophoresis assays generated one band for each DNA sample ranging from 1, 000 bp to 2, 000 bp (Suppl. material 1: Fig. S5). Interestingly, one 1318 bp sequence of SP73 shared high percentage identity with Y-specific BAC clone 009-41-10L-1 from previous studies (AP017638.1) (99%) (Suppl. material 1: Fig. S6). Another target band of a 1354 bp-SP75 DNA sequence (Suppl. material 1: Fig. S5) containing 907 bp Gypsy/DIRS1 RT sequence also presented a high-percentage homologous DNA with Y -specific BAC clone 009-41-10L-1 (AP017638.1) (99%) (Suppl. material 1: Fig. S7) and with a male-specific SCAR marker of spinach (FJ169475.1) (99%). SP76 was 1, 163 bp (Suppl. material 1: Fig. S5) and contained 939 bp Gypsy/DIRS1 RT DNA sequence. SP77 was 1, 154 bp (Suppl. material 1: Fig. S5) and contained 940 bp Gypsy/DIRS1 RT DNA sequence. PCR products with specific amplified bands were purified to construct fluorescent probes.

For chromosomal localization, 45S rDNA was used as a probe to distinguish each chromosome, the prominent fluorescent signals of which were observed on chromosomes 2, 5, and 6 (Deng et al. 2012). Initially, the homologous sex chromosome pair was identified by 45S rDNA probes based on the weak signals from X and Y chromosomes (Deng et al. 2012). This was the largest homologous pair among the six pairs of chromosomes. FISH performed using SP73 and SP75 as DNA probes detected an even distribution of fluorescence signal on each pair of homologous chromosomes. Those signals were concentrated near the putative centromere and pericentromeric regions. Stronger signals observed on the sex chromosomes compared to that on the A chromosomes. Nevertheless, no significant difference of fluorescence signals was found between X and Y chromosomes (Figs 2, 3). In addition, hybridization signals primarily appeared near the putative centromeres for each homologous chromosome pair by using SP76 and SP77 probes for FISH, and sporadic signals existed on the long arms. X and Y chromosomes were not distinguished based on signals (Figs 4, 5).

Figure 2.

Distribution patterns of hybridization signals from female and male spinach using 45S rDNA (green) and SP73 (red) as probes A (A’), DAPI B (B’), 45S rDNA (green) as probe C (C’), SP73 (red) as probe D (D’), The merged figure of A (A’), B (B’) and C (C’). Scale bas: 10 μm.

Figure 3.

Distribution patterns of hybridization signals from female and male spinach using 45S rDNA (green) and SP75 (red) as probes A (A’), DAPI B (B’), 45S rDNA (green) as probe C (C’), SP75 (red) as probe D (D’), The merged figure of A (A’), B (B’) and C (C’). Scale bars: 10 μm.

Figure 4.

Distribution patterns of hybridization signals from female and male spinach using 45S rDNA (green) and SP76 (red) as probes A (A’), DAPI B (B’), 45S rDNA (green) as probe C (C’), SP76 (red) as probe D (D’), The merged figure of A (A’), B (B’) and C (C’). Scale bars: 10 μm.

Figure 5.

Distribution patterns of hybridization signals from female and male spinach using 45S rDNA (green) and SP77 (red) as probes A (A’) DAPI B (B’) 45S rDNA (green) as probe C (C’) SP77 (red) as probe D (D’). The merged figure of A (A’), B (B’) and C (C’). Scale bars: 10 μm.

Discussion

The establishment of single chromosome subtractive hybridization technique in spinach

Chromosome microdissection technology has the advantage of being able to isolate specific DNA products from a single chromosome. Moreover, the isolated products of the target sequences can be enriched through PCR (Zhou et al. 2007). In this study, we combined the conventional genomic subtraction hybridization with single chromosome microdissection to rapidly clone male-biased DNA sequences from spinach sex chromosomes. Twenty-one of 55 cloned DNA sequences were partially overlapped to BAC clone 009-126-13E-1, BAC clone 009-160-1L-1, BAC clone 009-26-14K-1, BAC clone 009-123-11N-1, and BAC clone 009-41-10L-1 located on the male-determining region of the spinach Y chromosome (Kudoh et al. 2018). Specifically, repetitive DNA sequence SP73 and SP75 shared more than 1000 bp highly-homologous sequences compared with the reported BAC clone 009-41-10L-1. The technique proposed above can be used to screen sex-biased DNA fragments of X and Y chromosomes in spinach.

FISH localization of male-biased repetitive DNA sequences in spinach

Sex reversal from hermaphroditism to dioecy in flowering plants requires two mutants, namely, one male-sterile mutant (generally for the first time) and one female-sterile mutant. These mutant sites are used to stabilize sex on a pair of chromosomes (Charlesworth and Charlesworth 1978, Charlesworth 2013). Subsequently, suppression recombination occurs and plays a substantial role in maintaining dioecy by preventing the segregation of hermaphrodite or sterile progenies through crossing over. Repetitive sequence insertion plays a major role in ceasing recombination and leads to the formation of sex determination region and divergence of homologous sex chromosomes. A large number of transposon DNA sequences were enriched in the sex-determining region of asparagus (Jamsari et al. 2004). In S. latifolia, the Y chromosome is the largest and has accumulated a large number of repeated DNA sequences. Further analysis showed that transposons are inserted into the Y chromosome more frequently than into the other parts of the genome. FISH results showed that Gypsy RTs on Y chromosome of S. latifolia were 2.7 times more than those of Copia RTs (Cermak et al. 2008). Kudoh et al. (2018) reported that a higher amount of repetitive DNA sequences has accumulated near the Y linked region in spinach. However, very few direct cytological studies have explored the repetitive DNA sequences around the sex-determining locus. The BAC clone sequences are only a part of the sex-linked non-recombining region (Kudoh et al. 2018). Thus, other strategies should be used to explore the DNA sequences on a non-recombining region. On the basis of the DOP-PCR products of X and Y chromosomes from previous studies (Deng et al. 2013), genomic subtractive hybridization and dot-blot hybridization identified the specific repetitive DNA sequences on spinach sex chromosomes. In this study, the obtained Y chromosome-specific repetitive DNA sequences are mostly Ty3-gypsy family RTs. However, Kudoh et al. (2018) reported that most of the repeats found in the Y chromosome region around the male-determining locus are novel Ty1-copia-like RTs. The main reason for this could be the fact that the BAC clone sequences is only part of the sex-linked non-recombining region. Moreover, FISH localization identified the distribution pattern of repetitive DNA sequences on the sex chromosomes and autosome of spinach. The fluorescence signals of the DNA sequences containing LTR/Copia were distributed in a dispersed manner on all chromosomes (Suppl. material 1: Fig. S4). Although the localization of SP73, SP75, SP76 and SP77 did not differ between sex and autosomes, it did differ on the concentration of signals. It is evident that sex chromosomes have an accumulation of such repeats (SP73 and SP75). However, no significant difference was found in fluorescence signal intensity between X and Y chromosomes (Figs 25). The limited discrepancy of repetitive DNA detected between X and Y chromosome could be related to the early stages of sex chromosomes in spinach. Another reason for this result maybe is that dot blotting tends to produce false positives. In Spinacia, except for the cultivated spinach accession, S. turkestanica (Iljin, 1936) and S. tetrandra (Steven ex M. Bieb., 1808) are two extra species. Heteromorphic sex chromosomes were found in some accessions from S. tetrandra besides the common homomorphic sex chromosomes (Fujito et al. 2015). Thus, male-biased repetitive DNA sequences obtained in this study can be used as probes to explore their distribution in the homomorphic and heteromorphic sex chromosomes and to elucidate their possible role in the evolution of spinach sex chromosome.

Acknowledgements

This work was financially supported by grants from the National Natural Science foundation of China (31770346, 31970240, and 31470334).

JZ, SW, and CD designed the experiments. JZ and SW conducted the study, processed the data and wrote the manuscript. LY, JZ, NL, SL, YZ, RQ, WG, and CD discussed the results and revised the manuscript. All authors have read and approved the final manuscript.

References

  • Abbott JK, Nordén AK, Hansson B (2017) Sex chromosome evolution: historical insights and future perspectives. Proceedings of the Royal Society B – Biological Sciences 284: e20162806. https://doi.org/10.1098/rspb.2016.2806
  • Asalone KC, Nelson MM, Bracht JR (2019) Novel sequence discovery by subtractive genomics. Journal of Visualized Experiments 143: e58877. https://doi.org/10.3791/58877
  • Bachtrog D (2003) Accumulation of Spock and Worf, two novel non-LTR retrotransposons, on the neo-Y chromosome of Drosophila miranda. Molecular Biology and Evolution 20(2): 173–181. https://doi.org/10.1093/molbev/msg035
  • Cermak T, Kubat Z, Hobza R, Koblizkova A, Widmer A, Macas J, Vyskot B, Kejnovsky E (2008) Survey of repetitive sequences in Silene latifolia with respect to their distribution on sex chromosomes. Chromosome Research 16(7): 961–976. https://doi.org/10.1007/s10577-008-1254-2
  • Charlesworth B, Charlesworth D (1978) A model for the evolution of dioecy and gynodioecy. American Naturalist 112(988): 975–997. https://doi.org/10.1086/283342
  • Cioffi MB, Bertollo LA, Villa MA, de Oliveira EA, Tanomtong A, Yano CF, Supiwong W, Chaveerach A (2015) Genomic organization of repetitive DNA elements and its implications for the chromosomal evolution of channid fishes. PLoS ONE 10(6): e0130199. https://doi.org/10.1371/journal.pone.0130199
  • Deng CL, Qin RY, Cao Y, Gao J, Li SF, Gao WJ, Lu LD (2013) Microdissection and painting of the Y chromosome in spinach (Spinacia oleracea). Journal of Plant Research 126: 549–556. https://doi.org/10.1007/s10265-013-0549-3
  • Faber-Hammond JJ, Phillips RB, Brown KH (2015) Comparative analysis of the shared sex-determination region (SDR) among salmonid fishes. Genome Biology and Evolution 7: 1972–1987. https://doi.org/10.1093/gbe/evv123
  • Fujito S, Takahata S, Suzuki R, Hoshino Y, Ohmido N, Onodera Y (2015) Evidence for a common origin of homomorphic and heteromorphic sex chromosomes in distinct Spinacia species. G3 (Bethesda) 5(8): 1663–1673. https://doi.org/10.1534/g3.115.018671
  • Gao Z, Fu S, Dong Q, Han F, Birchler JA (2011) Inactivation of a centromere during the formation of a translocation in maize. Chromosome Research 19(6): 755–761. https://doi.org/10.1007/s10577-011-9240-5
  • Harkess A, Zhou J, Xu C, Bowers JE, Van der Hulst R, Ayyampalayam S, Mercati F, Riccardi P, McKain MR, Kakrana A, Tang H, Ray J, Groenendijk J, Arikit S, Mathioni SM, Nakano M, Shan H, Telgmann-Rauber A, Kanno A, Yue Z, Chen H, Li W, Chen Y, Xu X, Zhang Y, Luo S, Chen H, Gao J, Mao Z, Pires JC, Luo M, Kudrna D, Wing RA, Meyers BC, Yi K, Kong H, Lavrijsen P, Sunseri F, Falavigna A, Ye Y, Leebens-Mack JH, Chen G (2017) The asparagus genome sheds light on the origin and evolution of a young Y chromosome. Nature Communications 8(1): e1279. https://doi.org/10.1038/s41467-017-01064-8
  • Hobza R, Ceqan R, Jesionek W, Kejnovsky E, Vyskot B, Kubat Z (2017) Impact of repetitive elements on the Y chromosome formation in plants. Genes (Basel) 8(11): e302. https://doi.org/10.3390/genes8110302
  • Hou P, Wu M (1995) The method and applications of genomic subtraction. Progress In Biochemistry And Biophysics 22(5): 394–397. [In Chinese]
  • Jamsari A, Nitz I, Reamon-Büttner SM, Jung C (2004) BAC-derived diagnostic markers for sex determination in asparagus. Theoretical and Applied Genetics 108(6): 1140–1146. https://doi.org/10.1007/s00122-003-1529-0
  • Kudoh T, Takahashi M, Osabe T, Toyoda A, Onodera Y (2018) Molecular insights into the non-recombining nature of the spinach male-determining region. Molecular Genetics and Genomics 293(2): 557–568. https://doi.org/10.1007/s00438-017-1405-2
  • Ma H, Moore PH, Liu Z, Kim MS, Yu Q, Fitch MM, Sekioka T, Paterson AH, Ming R (2004) High-density linkage mapping revealed suppression of recombination at the sex determination locus in papaya. Genetics 166(1): 419–436. https://doi.org/10.1534/genetics.166.1.419
  • Mehrotra S, Goyal V (2014) Repetitive sequences in plant nuclear DNA: types, distribution, evolution and function. Genomics Proteomics & Bioinformatics 12(4): 164–171. https://doi.org/10.1016/j.gpb.2014.07.003
  • Ming R, Hou S, Feng Y, Yu Q, Dionne-Laporte A, Saw JH, Senin P, Wang W, Ly BV, Lewis KL, Salzberg SL, Feng L, Jones MR, Skelton RL, Murray JE, Chen C, Qian W, Shen J, Du P, Eustice M, Tong E, Tang H, Lyons E, Paull RE, Michael TP, Wall K, Rice DW, Albert H, Wang ML, Zhu YJ, Schatz M, Nagarajan N, Acob RA, Guan P, Blas A, Wai CM, Ackerman CM, Ren Y, Liu C, Wang J, Wang J, Na JK, Shakirov EV, Haas B, Thimmapuram J, Nelson D, Wang X, Bowers JE, Gschwend AR, Delcher AL, Singh R, Suzuki JY, Tripathi S, Neupane K, Wei H, Irikura B, Paidi M, Jiang N, Zhang W, Presting G, Windsor A, Navajas-Pérez R, Torres MJ, Feltus FA, Porter B, Li Y, Burroughs AM, Luo MC, Liu L, Christopher DA, Mount SM, Moore PH, Sugimura T, Jiang J, Schuler MA, Friedman V, Mitchell-Olds T, Shippen DE, dePamphilis CW, Palmer JD, Freeling M, Paterson AH, Gonsalves D, Wang L, Alam M (2008) The draft genome of the transgenic tropical fruit tree papaya (Carica papaya Linnaeus). Nature 452(7190): 991–996. https://doi.org/10.1038/nature06856
  • Na JK, Wang J, Ming R (2014) Accumulation of interspersed and sex-specific repeats in the non-recombining region of papaya sex chromosomes. BMC Genomics 15(1): 1–12. https://doi.org/10.1186/1471-2164-15-335
  • Onodera Y, Yonaha I, Masumo H, Tanaka A, Niikura S, Yamazaki S, Mikami T (2011) Mapping of the genes for dioecism and monoecism in Spinacia oleracea L.: evidence that both genes are closely linked. Plant Cell Reports 30: 965–971. https://doi.org/10.1007/s00299-010-0998-2
  • Straus D, Ausubel FM (1990) Genomic subtraction for cloning DNA corresponding to deletion mutations. Proceedings of the National Academy of Sciences of the United States of America 87: 1889–1893. https://doi.org/10.1073/pnas.87.5.1889
  • Takahata S, Yago T, Iwabuchi K, Hirakawa H, Suzuki Y, Onodera Y (2016) Comparison of spinach sex chromosomes with sugar beet autosomes reveals extensive synteny and low recombination at the male-determining locus. Journal of Heredity 107(7): 679–685. https://doi.org/10.1093/jhered/esw055
  • Vanburen R, Zeng F, Chen C, Zhang J, Wai CM, Han J, Aryal R, Gschwend AR, Wang J, Na JK, Huang L, Zhang L, Miao W, Gou J, Arro J, Guyot R, Moore RC, Wang ML, Zee F, Charlesworth D, Moore PH, Yu Q, Ming R (2015) Origin and domestication of papaya Yh chromosome. Genome Research 25(4): 524–533. https://doi.org/10.1101/gr.183905.114
  • Wang J, Na JK, Yu Q, Gschwend AR, Han J, Zeng F, Aryal R, VanBuren R, Murray JE, Zhang W, Navajas-Pérez R, Feltus FA, Lemke C, Tong EJ, Chen C, Wai CM, Singh R, Wang ML, Min XJ, Alam M, Charlesworth D, Moore PH, Jiang J, Paterson AH, Ming R (2012) Sequencing papaya X and Yh chromosomes reveals molecular basis of incipient sex chromosome evolution. Proceedings of the National Academy of Sciences of the United States of America 109(1): 13710–13715. https://doi.org/10.1073/pnas.1207833109
  • Xu C, Jiao C, Sun H, Cai X, Wang X, Ge C, Zheng Y, Liu W, Sun X, Xu Y, Deng J, Zhang Z, Huang S, Dai S, Mou B, Wang Q, Fei Z, Wang Q (2017) Draft genome of spinach and transcriptome diversity of 120 Spinacia accessions. Nature Communications 8: e15275. https://doi.org/10.1038/ncomms15275
  • Yu Q, Hou S, Hobza R, Feltus FA, Wang X, Jin W, Skelton RL, Blas A, Lemke C, Saw JH, Moore PH, Alam M, Jiang J, Paterson AH, Vyskot B, Ming R (2007) Chromosomal location and gene paucity of the male specific region on papaya Y chromosome. Molecular Genetics and Genomics 278(2): 177–185. https://doi.org/10.1007/s00438-007-0243-z
  • Zhou Q, Zhang J, Bachtrog D, An N, Huang Q, Jarvis ED, Gilbert MT, Zhang G (2014) Complex evolutionary trajectories of sex chromosomes across bird taxa. Science 346: 1332–1340. https://doi.org/10.1126/science.1246338
  • Zhou RN, Hu ZM (2007) The development of chromosome microdissection and microcloning technique and its applications in genomic research. Current Genomics 8(1): 67–72. https://doi.org/10.2174/138920207780076929