Research Article |
|
Corresponding author: Laurian Parmentier ( laurian.parmentier@gmail.com ) Corresponding author: Roger Vila ( roger.vila@ibe.upf-csic.es ) Academic editor: Nazar Shapoval
© 2022 Laurian Parmentier, Roger Vila, Vladimir Lukhtanov.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Parmentier L, Vila R, Lukhtanov V (2022) Integrative analysis reveals cryptic speciation linked to habitat differentiation within Albanian populations of the anomalous blues (Lepidoptera, Lycaenidae, Polyommatus Latreille, 1804). Comparative Cytogenetics 16(4): 211-242. https://doi.org/10.3897/CompCytogen.v16.i4.90558
|
The Balkan Peninsula is one of the greatest hotspots for biodiversity in Europe. While the region has been investigated thoroughly, some parts remain understudied and may still harbour undiscovered diversity, even in well-studied organisms such as Lepidoptera. Here we investigated the group of the so-called anomalous blue butterflies, also known as ‘brown complex’ of the subgenus Agrodiaetus Hübner, 1822 including the taxa of the entire Polyommatus aroaniensis (Brown, 1976) species complex. This species complex is distributed in the southern part of the Balkan Peninsula and known to be represented by three closely related allopatric species, differentiated by their chromosome numbers (n) and mitochondrial (mt) DNA. These are P. aroaniensis sensu stricto (Southern Greece, Peloponnese, n=47–48; mt haplogroup aroa1), P. timfristos Lukhtanov, Vishnevskaya et Shapoval, 2016 (Central Greece, Attika, n=38, aroa2) and P. orphicus Kolev, 2005 (North-Eastern Greece, Southern Bulgaria, n=41–42, orph1).
Based on an analysis of chromosomal, molecular and morphological markers, we demonstrate that a fourth taxon of this species complex exists in Albania. This taxon possesses the mt haplogroup aroa3, which is the most differentiated within the entire P. aroaniensis species complex, and the karyotype (n=42–43), which differs by one fixed chromosome fission from P. orphicus. The Albanian taxon seems to be ecologically specialised (habitat on dark-coloured, ophiolitic substrate soils) and differs in colouration (wing reflectance) from the others taxa of the P. aroaniensis species group. Based on the evidence here presented and following the current view of the taxonomy of the group, we propose considering the Albanian taxon as a new species, here described as Polyommatus lurae sp. nov. At the contact zone between the new species and P. orphicus, in addition to typical ones, we detected specimens with haplogroup orph2, karyotype n=43 and intermediate morphology, which seem to represent P. lurae × P. orphicus hybrids.
biodiversity, chromosome number, COI, conservation, DNA barcoding, karyotype, mitochondrial marker, protected species, wing colour morphometrics
The so-called anomalous blues of the subgenus Agrodiaetus Hübner, 1822 constitute a distinct lineage within the species-rich genus Polyommatus Latreille, 1804 (
In Europe, most Agrodiaetus species are restricted to the southern warm parts of the continent, and most of them are endemic to relatively small areas. The Balkans are one of the richest European regions for subgenus Agrodiaetus (
The first species of “brown” Agrodiaetus described as endemic to the Balkans was P. aroaniensis (Brown, 1976). After
Then, almost three decades later, Lukhtanov and
The above shows that the systematics of the “brown” Agrodiaetus is complex. Indeed, more recently,
Generally, identification of species in the subgenus Agrodiaetus remains challenging because of considerable geographic and individual variability in habitus (
Thus, an integrative analysis combining multiple markers and techniques may be the best solution to resolve complex systematics and to uncover potential cryptic diversity in the Agrodiaetus subgenus (
All butterflies were collected by L. Parmentier at the different biotopes investigated in Albania, in the provinces of Korçë, Elbasan, Dibër and Kukës. Collected samples were put in glassine envelopes in the field, a unique code assigned to each and stored in cooled plastic boxes. At different sites, a selection of fresh male samples was kept alive, until the posterior part of the abdomen was removed for karyological analysis. Taking into account the possibility of multiple cryptic species within a local area even in well-studied European butterflies (
In order to elucidate the genetics of the subgenus Agrodiaetus in Albania, we analysed DNA of 41 Albanian specimens (males and females). To put them in context, we mined 19 additional COI sequences from GenBank, a subset where the most similar sequences to the Albanian ones were included and overlapped at least 650 base pairs (bp) of the cytochrome c oxidase subunit (COI). DNA extraction was done following the protocol described in
List of the studied samples of brown Polyommatus (Agrodiaetus) from Albania.
| GenBank nr COI barcode | GenBank nr ITS2 | LPA coll code | RV coll code | Karyo–type ID | Species | Sex | Chromo–some number | Mt haplo-group (lineage) | Locality | Remark biotope: soil type |
|---|---|---|---|---|---|---|---|---|---|---|
| ON715909 | – | 17-70-01 | 17E536 | – | P. orphicus | F | – | orph2 | Valikardhë region, Zerqan | Pure karst soil |
| ON715910 | – | 17-70-02 | 17F269 | – | P. orphicus | M | – | orph2 | Valikardhë region, Zerqan | Pure karst soil |
| ON715911 | OP537928 | 18-70-K75 | 18D275 | K75 | P. orphicus | M | n=42 | orph2 | Valikardhë region, Zerqan | Pure karst soil |
| ON715912 | – | 18-111-K11 | 18D211 | – | P. orphicus | M | – | orph2 | Valikardhë | Pure karst soil |
| ON715913 | – | 18-111-K48 | 18D248 | – | P. orphicus | M | – | orph2 | Valikardhë | Pure karst soil |
| ON715914 | – | 18-111-K18 | 18D218 | – | P. orphicus | M | – | orph2 | Valikardhë | Pure karst soil |
| ON715915 | – | 18-111-K93 | 18D293 | – | P. orphicus | M | – | orph2 | Valikardhë | Pure karst soil |
| ON715916 | – | 18-111-K94 | 18D294 | – | P. orphicus | F | – | orph2 | Valikardhë | Pure karst soil |
| ON715917 | – | 18-111-K95 | 18D295 | – | P. orphicus | F | – | orph2 | Valikardhë | Pure karst soil |
| ON715918 | – | 18-111-K25 | 18D225 | – | P. orphicus | M | – | orph2 | Valikardhë | Pure karst soil |
| ON715919 | OP537929 | 18-111-K78 | 18D278 | – | P. orphicus | F | – | orph2 | Valikardhë | Pure karst soil |
| ON715923 | – | 18-124-X103 | 22A030 | – | P. orphicus | M | – | orph2 | Lurë region, NW of Cidhën | Pure karst soil |
| ON715924 | – | 18-124-X104 | 22A031 | – | P. orphicus | M | – | orph2 | Lurë region, NW of Cidhën | Pure karst soil |
| ON715925 | OP537930 | 18-115-K76 | 18D276 | K76 | P. orphicus | M | n=42 | orph2 | Lurë region, Fushë Lurë | Valley near 2nd mountain, karst soil |
| ON715926 | – | 18-115-K66 | 18D266 | – | P. orphicus | M | – | orph2 | Lurë region, Fushë Lurë | Pure karst soil |
| ON715927 | – | 18-115-K67 | 18D266 | – | P. orphicus | M | – | orph2 | Lurë region, Fushë Lurë | Pure karst soil |
| ON715920 | – | 18-115-X97 | 22A024 | – | P. orphicus | M | – | orph2 | Lurë region, Fushë Lurë | Mixed ophiolite/karst soil |
| ON715921 | – | 18-115-X101 | 22A026 | – | P. orphicus | M | – | orph2 | Lurë region, Fushë Lurë | Mixed ophiolite/karst soil |
| ON715922 | – | 18-115-X102 | 22A029 | – | P. orphicus | F | – | orph2 | Lurë region, NW of Arras | Mixed ophiolite/karst soil |
| ON715928 | – | 18-115-K80 | 18D280 | K80 | P. orphicus | M | n=42 | orph2 | Lurë region, Fushë Lurë | Mixed ophiolite/karst soil |
| ON715929 | – | 18-115-K84 | 18D284 | K84 | P. orphicus | M | n=42 | orph2 | Lurë region, Fushë Lurë | Mixed ophiolite/karst soil |
| ON715930 | OP537931 | 18-115-K85 | 18D285 | K85 | P. orphicus | M | n=42 | orph2 | Lurë region, Fushë Lurë | Mixed ophiolite/karst soil |
| ON715905 | – | 17-94-3 | 17E542 | 2017–03 | P. lurae × orphicus putative hybrid | M | n=43, 44 | orph2 | Lurë region, Gurë-Lurë | Nectaring on flowers along road |
| ON715910 | – | 18-115-K69 | 18D269 | K69 | P. lurae × orphicus putative hybrid | M | n=43 | orph2 | Lurë region, Fushë Lurë | Mixed ophiolite/karst soil |
| ON715921 | – | 18-115-K83 | 18D283 | K83 | P. lurae × orphicus putative hybrid | M | n=43 | orph2 | Lurë region, Fushë Lurë | Mixed ophiolite/karst soil |
| ON715908 | – | 18-115-K90 | 18D290 | K90 | P. lurae × orphicus putative hybrid | M | n=43 | orph2 | Lurë region, Fushë Lurë | Mixed ophiolite/karst soil |
| ON715895 | – | 18-115-X98 | 22A025 | – | P. lurae sp. nova | M | – | orph2 | Lurë region, Fushë Lurë | Mixed ophiolite/karst soil |
| ON715896 | OP537924 | 18-115-K71 | 18D271 | K71 | P. lurae sp. nova | M | n=41+ trivalent | aroa3 | Lurë region, Fushë Lurë to Qafa e Lura | Ophiolite soil+mixed, paratype male |
| ON715897 | – | 18-115-K73 | 18D273 | K73 | P. lurae sp. nova | M | n=42 | aroa3 | Lurë region, Fushë Lurë | Mixed ophiolite/karst soil, paratype male |
| ON715898 | OP537925 | 18-116-K68 | 18D268 | K68 | P. lurae sp. nova | M | n=ca.42 | aroa3 | Lurë region, Qafa e Lura | Ophiolite soil, paratype male |
| ON715899 | – | 18-116-K70 | 18D270 | – | P. lurae sp. nova | M | – | aroa3 | Lurë region, Qafa e Lura | Ophiolite soil, paratype male |
| ON715900 | OP537926 | 18-116-K77 | 18D277 | – | P. lurae sp. nova | F | – | aroa3 | Lurë region, Qafa e Lura | Ophiolite soil, paratype female |
| ON715903 | OP537927 | 18-116-K81 | 18D281 | – | P. lurae sp. nova | M | – | aroa3 | Lurë region, Qafa e Lura | Ophiolite soil, paratype male |
| ON715901 | – | 18-116-X100 | 22A028 | K82 | P. lurae sp. nova | M | n=43 | aroa3 | Lurë region, Qafa e Lura | Ophiolite soil, HOLOTYPE male |
| ON715904 | – | 18-118-K88 | 18D288 | K88 | P. lurae sp. nova | M | n=42 | aroa3 | Lurë region, Pregj Lurë | Ophiolites, paratype male |
| ON715902 | – | 18-119-K79 | 18D279 | – | P. lurae sp. nova | M | – | aroa3 | Lurë region, Pregj Lurë | Ophiolites, paratype male |
The COI analysis involved 60 sequences (19 GenBank sequences and 41 own material). For the COI phylogeny, sequences of different length (from 647 to 657 bp) were included into the final dataset alignment. We used Geneious Prime 2019.0.3 (https://www.geneious.com) software to align the sequences and then edited them manually. The final COI alignment included 657 sites, with 137 variable sites and 112 parsimony-informative sites. A phylogeny was reconstructed in BEAST v2.5.0 (
Based on
Testes were removed within 1 hour after collection and were stored in the 3:1 fixative for several months at +4 °C and then stained with 2% acetic orcein for 30 days at 20 °C. In total we karyotyped a selection of 15 samples representative for the different species and biotopes handled in this paper. We used a two-phase method of chromosome analysis as described in
Leica DM2500 light microscope equipped with HC PL APO 100×/1,44 Oil CORR CS lens and S1/1.4 oil condenser head was used for bright-field microscopy analysis. Leica lens HC PL APO 100×/1,40 OIL PH3 was used for phase-contrast microscopy analysis.
Wing colour is an important trait for identification of butterflies and a species-specific characteristic (
NMDS plots based on 27 specimens were obtained using the Adonis script (Vegan package) in R (
Posterior statistics was done running a permutational multivariate analysis of variance, using distance matrices with the Adonis call (Vegan package) in R (
In total, 251 Agrodiaetus samples belonging to the P. aroaniensis and P. ripartii species complexes were analysed. Specimens were collected from 94 Albanian different sites visited and distributed from Southern up to North-eastern Albania. Only in a minor part of the sites (7/94 sites), specimens were identified as belonging to the P. aroaniensis species complex, mostly in provinces Dibër and Korçë. Specimens with clear P. ripartii traits – based on habitus descriptions given by
Biotope and specimens in their natural biotopes at the Lurë region a P. lurae sp. nov uns. (sample code 18-115-K71), Albania, Dibër prov., Lurë region, 24.VII.2018 in its biotope b P. lurae sp. nov ups., same specimen c Albanian P. orphicus (sample code 18-124-X103) in its biotope on Karst substrate, Dibër prov., Lurë region, 25.VII.2018, NW of Cidhën village d typical biotope of P. lurae with dark ophiolitic soil substrate e, f Onobrychis alba, host plant for Polyommatus (Agrodiaetus) sp., growing in ophiolitic soil substrate.
The phylogeny obtained by Bayesian inference based on 658-bp of the gene COI (Fig.
Bayesian inference tree based on 658-bp of the gene COI for the entire Polyommatus aroaniensis species complex. Node posterior probabilities (0.80 and higher) are written on the branches. The scale bar indicates the length of 0.005 substitutions/site. Main clades are highlighted and COI haplogroups and karyotype numbers indicated: P. orphicus orphicus/eleniae (orph1, n=41–42), P. orphicus Albania (orph2, n =42), P. aroaniensis (aroa1, n=47–48), P. timfristos (aroa2, n=38) and P. lurae sp. nov (aroa3, n=42–43). Brown dots next to specimens within the orph2 clade indicate P. lurae × P. orphicus potential hybrids (n=43–44) found in the contact zone or dispersing.
To construct the haplotype network, we used 54 specimens that were collapsed in 28 haplotypes representing 7 haplogroups (Fig.
Haplotype network of the P. aroaniensis species group in relation to P. damon and P. ripartii. Coloured circles represent different taxa, as indicated in the legend; coloured boxes delimitate the haplogroups discussed in the text. Each line segment represents a mutation step, and black small circles represent “missing” haplotypes.
The phylogenies based on the concatenated COI+ITS2 sequences (54 specimens, same as the haplotype network) and using the BI and NJ methods are given in Suppl. material
In all cases using different phylogenetic reconstruction models, and based on COI or concatenated COI+ITS2 sequences, P. lurae sp. nov formed a monophyletic, well differentiated clade with very good support.
In five studied samples (K75, K76, K80, K84, K85) the number of countable elements was found to be n=42 at MI and MII cells. Bivalents at MI and univalents at MII were fairly well differentiated with respect to their size; however, it was difficult to subdivide them objectively into size groups because the sizes of the elements decrease more or less linearly (Fig.
In five studied samples (K68, K71, K73, K81, K88), two different haploid chromosome numbers (n=42 and n=43) were observed at MI and MII cells of the 14 specimens studied. This variation was most likely caused by polymorphism for one chromosome fusion/fission. This polymorphism resulted in three types of MI karyotype: n=42 (homozygous for chromosomal fusion/fission, one pair of fused chromosomes; 2n=84), n=43 (homozygous for chromosomal fusion/fission, two pairs of unfused chromosomes; 2n=86) and n=42 (heterozygous for chromosomal fusion/fission, resulting in 41 bivalents and one trivalent; 2n=85). Bivalents at MI and univalents at MII were fairly well differentiated with respect to their size; however, it was difficult to subdivide them objectively into size groups because the sizes of the elements decrease more or less linearly (Fig.
The contact zone between the two species was defined as the area where both orph2 and aroa3 haplogroups were found to coexist, and coincided with a mixed ophiolite/karst substrate. In this area, in addition to specimens typical to either species, a number of countable elements of n=43 at MI and MII cells was found for three samples with a mitochondrial haplogroup orph2 (samples K69, K83, and K90). Bivalents at MI and univalents at MII were fairly well differentiated with respect to their size; however, it was difficult to subdivide them objectively into size groups because the sizes of the elements decrease more or less linearly (Fig.
A distribution map based on current literature and predictions of the anomalous blues within the P. aroaniensis species complex in the Balkan peninsula is shown in Fig.
a distribution map based on literature and predictions of the anomalous blues within the P. aroaniensis species complex in the Balkan peninsula; colours correspond to the species in the legend; box is indicating the Lurë region in Albania b detailed map of the Lurë region with observations of P. lurae sp. nov (black dots) on dark ophiolites, P. orphicus (brown dots) and putative hybrids (blue dots) in the contact zone (blue dots) and a dispersive specimen outside suitable biotope (paler blue dot).
The upperside wing colour is one of the main characteristic features of the anomalous blue butterflies.
We also analysed light reflection of male wings based on standardized colour measurements (RGB and HSV values) for 27 specimens. We focused on the species P. orphicus and P. lurae, and also included the few potential hybrid specimens (based on the atypical combination of mitochondrial haplogroup and karyotype results and always collected at the contact zone in the Lurë region. NMDS plots (Fig.
The colouration and wing pattern of P. lurae sp. nov, P. orphicus and P. ripartii. The letters correspond to the following species (and voucher sample codes as listed in Table
NMDS plot representing the morphometric analysis of dorsal male wings reflectance measurements of P. orphicus (orange dots) and P. lurae sp. nov (black dots). Stress = 0.02; specimens indicated in blue are potential P. lurae × P. orphicus hybrids collected in the contact zone and showed intermediate wing reflectance. Different symbols represent collection sites of three studied habitat with different substrate types (ophiolitic, karst, mixed). Ellipses represent 95% confidence intervals of specimen groups ‘orphicus’, ‘lurae’ and ‘hybrid’.
Next to this, a link with the soil substrate was tested and statistical analysis revealed that both species P. lurae and P. orphicus could significantly be linked with their locations harbouring typical soil substrates, i.e. dark ophiolitic versus light karts soils, respectively (Df= 3, F=4.39, P=0.014).
The results showed a consensus between morphometrics, mitochondrial DNA and karyotype, in delineating three clades under the P. aroaniensis species complex. Two of them are generally accepted as species: P. aroaniensis and P. timfristos (
Typical dark ground colour of both veins and intervein space of dorsal wing sides. A character that appears useful for separation of P. orphicus and P. lurae sp. nov is the brighter yellow-greenish reflection of the former which is generally lacking in the newly described taxon. However, worn individuals of the two taxa may be indistinguishable externally and also from P. ripartii, which is found sympatrically in all locations studied. While
(Fig.
Nine males and one female were studied in depth, with field codes of voucher specimen in LP collection (RVcoll number/ GenBank accession numbers of barcodes): LP18-115-K71 (RVcoll18D271/ ON715896), LP18-115-K73 (RVcoll18D273/ON715897), LP18-116-K68 (RVcoll18D268/ ON715898), LP18-116-K70 (RVcoll18D270/ ON715899), LP18-116-K77 (RVcoll18D277/ ON715900), LP18-116-K81 (RVcoll18D281/ ON715903), LP18-116-X100 (RVcoll22A028/ON715903), LP18-115-X98 (RVcoll22A025/ON715895), all North of Cidhën near Fushë Lurë, 1050–1600m. 23–24.VII.2018; LP18-118-K88 (RVcoll18D288/ ON715904), LP18-119-K79 (RVcoll18D279/ ON715902) Lurë region, Pregj Lurë 24.VII.2018. Additional material: 15 males, 5 females, same localities, collection dates 23- 24.VII.2018. All paratypes have red labels indicating P. lurae sp. nov, name of authors, signature of first author and exact localities.
The haploid chromosome number P. lurae sp. nov is determined as n=42–43 (Fig.
657 base pairs: AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTCTAAGAATTTTAATTCGTATGGAATTAAG
AACTCCTGGATCCTTAATTGGAAATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATA
ATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTTCCCTTAATATTAGGAG
CACCTGATATAGCCTTTCCCCGATTAAATAATATGAGATTTTGATTATTACCACCATCATTAATACTACT
AATTTCTAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAAT
ATTGCACATAGAGGATCATCTGTAGATTTAGCAATTTTCTCTCTTCATTTAGCAGGAATTTCTTCAATTT
TAGGAGCAATTAATTTTATTACAACTATCATTAATATACGAGTAAATAATTTATCTTTTGATCAAATATC
ATTATTTATTTGAGCAGTGGGAATTACAGCATTATTATTACTTTTATCATTGCCTGTATTAGCTGGAGCA
ATTACCATATTACTAACAGATCGAAACCTTAATACCTCATTCTTTGACCCAGCTGGTGGAGGAGATCCAA
TTTTATATCAACATTTATTT.
Males. (Fig.
Male genitalia. The valva of the male genitalia of P. lurae sp. nov is depicted in Fig.
Females. Forewing length 15.8–17.5 mm. Upperside: ground colour as in males, but lighter dark brown and without sex brand and scaletuft. Fringe greyish brown. Underside: ground colour and general design as in males but fringes lighter-coloured. Greenish blue basal suffusion almost invisible. White streak on hindwing underside mostly absent (Fig.
Polyommatus lurae inhabits xerothermic and xeromontane ophiolitic habitats. While in some of the localities the soil can be mixed with a minor degree of a calcareous component, P. lurae was never found at pure calcareous biotopes. Indeed, at such localities only P. orphicus was found, together with P. ripartii, which is in agreement with the original description of these species (Kolev, 2005). The vegetation of the type locality is sparse and dominated by low-growing grasses and flowering plants identified as Artemisia alba Turra and Satureja montana Linnaeus. Besides, other xerophilous species were observed, including scattered Juniperus bushes and low Pinus nigra trees (Fig.
The three known localities of P. lurae (including the type locality) are situated in the Lurë region, in the vicinity of the National Park (Parku Kombëtar Lurë-Mali i Dejës), North of the village Cidhën, along a North-Southern orientated mountain ridge and gorge at altitudes between 950 and 1.600 m (Fig.
The aforementioned ophiolitic substrates can be found in a discontinuous range from Southern Albania (Provinces Korcë, Qukës) up to the Northern part of the country (provinces Dibër, Kukës). Within Europe these rather rare substrates are present mostly in Albania, while neighbouring countries of North Macedonia and Kosovo contain them to a minor degree. Thus, it is not impossible that the species is also present in other ophiolitic habitats where the presumed host plant is growing. Collection material from another locality in Voskopojë (Korçë prov.), situated more South, also harbouring typical dark ophiolitic soils was studied. In this locality, a single specimen (RVcoll14B767) genetically attributable to P. lurae was found by Sylvain Cuvelier and Morten Mølgaard, but it is not included in the type series because of the lack of karyological data and morphometrics. Additional specimens from this locality could not be found even after thorough explorations in 2018 and 2022, while only P. ripartii could be confirmed.
From nominotypical P. orphicus the new taxon is generally distinguished by the strong reduction of a white postdiscal streak on the forewing underside, a darker colour of the upperside and underside wing, lack of wing reflectance, and less contrasting veins on the upperside. Its karyotype is different by at least one fixed chromosome fission (n=41–42) and its COI barcode. From P. aroaniensis, which is the most similar taxon externally, fresh individuals of the new taxon are distinguished by the constant presence of a typical dark ground colour of both veins and intervein space of dorsal wing sides and a generally darker colour of the upperside and underside wing (while in aroaniensis a warm reddish brown colour is typical). However, worn individuals may be indistinguishable externally, while they still can be identified by karyotype (n=48) and by the COI barcode. In the case of P. lurae, its dark habitus is linked to its typical environment with dark ophiolites, while the taxa P. orphicus and P. aroaniensis are generally found in biotopes with paler karst soil substrate. From the sympatric and syntopic P. ripartii, the new taxon is more easily distinguished by the absence of a white postdiscal streak on the forewing underside and, on average, a more reduced appearance of postdiscal spots, and on the upperside the veins are less pronounced and of a similar tone than the paler ground colour. This may be useful for discriminating even slightly worn individuals of the two taxa, while worn individuals are mostly indistinguishable externally. Yet, its karyotype (n=90) and COI barcode are strongly different. P. admetus has not been observed on the same biotopes and thus the new taxon could be separated geographically. Besides, P. admetus has a very distinct appearance by especially its strongly marked underside (with a double row of small dots on the marginal to submarginal zone of the underside hindwings, a trait that is lacking in the aforementioned species.
Derivatio nominis.
The adjective lurae has two meanings: “ascribed to Lurë” and “surviving attacks of congeners”. First, the species name is deducted from the Albanian “Lurë region, where the type locality lies, and referring to the old village Lurë e Vjetër situated in central-Eastern Albania (Dibër province). The name alludes to the fascinating history of the old Lurë village: during the Ottoman war, the village was asked 300 women by the enemies. Armed men, disguised with the duvak, the traditional red bridal veil, were sent instead on horseback to the Ottoman camp. As a result, the Ottomans were taken by surprise and the Lura tribe eventually won the battle. Also, this second meaning seems adequate for the taxon lurae: this species likely experienced periods of close contact with congener species more largely distributed in the Balkans, as is the case at present, but nevertheless has been able to avoid complete admixture and still survives in its unique ophiolitic biotope.
The use of standardized light reflectance measurements to discriminate between species is a recent method used for identification (
The karyotype of P. orphicus was studied previously (
The P. orphicus karyotype found by us in Albania (n=42) fits into the previously described variability. At the same time, it can be assumed that in the Albanian population there is a tendency to fixation of the chromosome number n=42, although the studied data are still insufficient to consider this proved.
The taxon we describe as P. lurae sp. nov also exhibits intrapopulation variability in chromosome numbers (n=42, n=43; estimated diploid numbers are 2n=84, 2n=85, 2n=86) due to polymorphism for one chromosome fusion/fission, but most likely in another chromosome pair. Thus, despite chromosome polymorphism in each of the taxa P. orphicus and P. lurae, they have, most likely, a fixed difference in one chromosome pair (Fig.
Scheme showing variation in number of chromosomes (lines) and visible elements (=bivalents+multivalents) in MI meiosis in P. orphicus, P. lurae and their putative F1 hybrids. a P. orphicus, homozygous for chromosomal fusion/fission, one pair of fused chromosomes, 41 visible elements b P. orphicus, heterozygous for chromosomal fusion/fission, 40 bivalents and one trivalent; 41 visible elements c P. orphicus, n=42 (homozygous for chromosomal fusion/fission, two pairs of unfused chromosomes; 42 visible elements d P. lurae, homozygous for chromosomal fusion/fission, one pair of fused chromosomes, 42 visible elements e P. lurae, heterozygous for chromosomal fusion/fission, 41 bivalents and one trivalent; 42 visible elements f P. lurae, homozygous for chromosomal fusion/fission, two pairs of unfused chromosomes; 43 visible elements g–j different variants of F1 hybrids. These variants include tri- and quadrivalents; however, the number of visible elements in MI remains 41.
In the contact zone in Albania, both mitochondrial haplogroups orph2 and aroa3 occur together. It can be assumed that they arose as a result of hybridization, which is confirmed by the intermediate nature of the colour of the wings.
In the case of hybridization, if contacting taxa have postzygotic reproductive isolation, then hybrid individuals should represent only F1 hybrids (further hybridization is impossible due to sterility). If the hybrids are fertile, then a mixture of hybrids of different generations and the results of backcrosses should be observed.
The reconstruction of karyotypes of pure forms of P. orphicus and P. lurae sp. nov and their putative hybrids is shown in Fig.
The data obtained demonstrate that P. orphicus and P. lurae represent two distinct phylogenetic lineages with a parapatric distribution. Indeed, both P. orphicus and P. lurae formed a highly supported monophyletic lineage based on three phylogenetic analyses (BI of COI barcode, ML of COI+ITS2 and BI of COI+ITS2) (Fig.
Theoretically, the main lineages in the P. orphicus, P. timfristos, P. aroaniensis and P. lurae subcomplex could also be interpreted as infraspecific taxa, if the polytypic species concept is applied (
Chromosome changes have been shown to be important for speciation in Polyommatina butterflies (
Regardless of its taxonomic status as a species or subspecies, P. lurae represents a unique entity within the genus Polyommatus that deserves additional study. A better understanding of its evolutionary history and its relationship with its unique biotope and related taxa may be helpful in understanding mechanisms of chromosomal diversification within the subgenus Agrodiaetus, and may further elucidate the biogeography of the south Balkan and Aegean regions.
The Lurë region has become a National Park (Parku Kombëtar Lurë-Mali i Dejës) since 1966 to protect its ecosystems and biodiversity. Since 2018 by encompassing the entire section of Kunora e Lurës, its name has changed to Parku Kombëtar Lurë-Mali i Dejës, spanning an expanded area of 202.42 km2. Despite its conservation status the area suffered massive deforestation from illegal logging and forest fires that severely affected ecosystems and it is estimated that as much as 50% of the original Lura National Park has been destroyed (
Next to this, the first author noticed that sheep overgrazing is also affecting the ecosystems. As Onobrychis plants are very palatable to sheep, heavy grazing limits the growth and expansion of Onobrychis, sometimes leading to the extinction of the plant (
The future of various endemic species of Polyommatus in Europe is strongly dependent on keeping open dry clearings at montane-subalpine levels where its foodplant is growing; This is the case for P. orphicus and P. aroaniensis in Greece but even so for P. lurae in Albania.
As a distinct taxonomic entity occupying a very restricted area linked to a unique biotope in Albania the newly described species should be considered a candidate on the list of protected species in Albania and the whole of Europe by adding to the European red list of Butterflies (
In summary, the Lurë region harbours unique endemic flora and fauna, in addition to being home for the species here described, which is currently only found very restricted and locally. Therefore, the preservation of this habitat needs being ensured. This encompasses also control of human activities as illegal logging, burning and uncontrolled grazing by livestock, all major factors that have been identified contributing to butterfly decline in Europe (
We thank Joan Carles Hinojosa and Cecília Corbella for COI and ITS2 sequencing and assistance on phylogenetic inference, Prof. Anila Papariso for help during the organization of field trips and for providing collecting permits (Permission n° 78567Pro. to Laurian Parmentier) and Prof. Lulezim Shuka for determination of plant species. John Coutsis is thanked for providing a drawing of the male genitalia. Thanks also to Sylvain Cuvelier and Morten Mølgaard for giving us permission to study samples collected from Voskopojë. The first author would like to thank Delphine Vincke for accompanying and for assistance during remote Albanian field trips. Thanks also to dr. Stefan Kerkhof (Koninklijk Belgische Instituut voor Natuurwetenschappen, KBIN, Brussels) for providing access to museum specimens in the public Lepidoptera collections under their care. Financial support for the molecular studies was provided by project PID2019-107078GB-I00 funded by Ministerio de Ciencia e Innovación (MCIN)/Agencia Estatal de Investigación (AEI)/ 10.13039/501100011033 to Roger Vila. Financial support for the cytogenetic studies was provided by Ministry of Science and Higher Education of the Russian Federation (grant no. 075-15-2021-1069) to Zoological Institute of the Russian Academy of Sciences. Analysis of putative chromosomal hybrids was supported by the Russian Science Foundation grant no 19-14-00202 (Continuation) to Vladimir Lukhtanov (Zoological Institute RAS). We finally want to thank the two reviewers for giving constructive comments on a previous version of the manuscript.
Laurian Parmentier https://orcid.org/0000-0003-4226-439X
Roger Vila https://orcid.org/0000-0002-2447-4388
Vladimir Lukhtanov https://orcid.org/0000-0003-2856-2075
Colour measurements of wing reflectance
Data type: morphological
Explanation note: Deatails on colour measurements (methodology, processing) and generated data are given.
Phylogeny of concatenated COI+ITS2 sequences based on NJ and BI reconstructions
Data type: docx file