Research Article |
|
Corresponding author: André Luís Laforga Vanzela ( andrevanzela@uel.br ) Academic editor: Julio R. Daviña
© 2017 André Luís Laforga Vanzela, Adriano Alves de Paula, Carolina Cristina Quintas, Thiago Fernandes, Joana Neres da Cruz Baldissera, Thaissa Boldieri de Souza.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Vanzela ALL, Paula AA, Quintas CC, Fernandes T, Baldissera JNC, Souza TB (2017) Cestrum strigilatum (Ruiz & Pavón, 1799) B chromosome shares repetitive DNA sequences with A chromosomes of different Cestrum (Linnaeus, 1753) species. Comparative Cytogenetics 11(3): 511-524. https://doi.org/10.3897/CompCytogen.v11i3.13418
|
Species of Cestrum (Linnaeus, 1753) have shown large diversity in the accumulation and distribution of repetitive DNA families, and B chromosomes have been described in seven species. Some types of repetitive DNA were identified in A and B chromosomes in species of this plant group, such as AT-rich SSR, 35S and 5S rDNA, C-Giemsa and C-CMA/DAPI bands and retrotransposons. To increase our understanding of the relationships of A and B chromosomes, the B of C. strigilatum Ruiz & Pavón, 1799 was microdissected, amplified and hybridized in situ against chromosomes of this species, and in six other species of this genus. FISH signals were observed in whole the B of C. strigilatum, including stretches of A chromosomes, as well as in some A chromosomes of all tested species. A strong FISH signal was seen adjacent to the 5S rDNA in the proximal region of pair 8 of all species and, due to this, we have searched for 5S rDNA fragments in the microdissected B chromosome. PCR and sequencing data evidenced 5S rDNA deletion along evolutionary pathways of the B of C. strigilatum. Although A and B chromosomes displayed redundancy in the repetitive DNA families in different species, the B of C. strigilatum seemed to differ from those Bs of other Cestrum species by the loss of rDNA fractions. A possible origin of Bs in Cestrum was discussed.
FISH, karyotypes, microdissection, rDNA, Solanaceae , supernumerary chromosomes
B chromosomes have been described as additional and dispensable components of genomes, especially because they show few or no essential genes, abundance of repetitive DNA families, and independent meiotic behavior, without pairing with A chromosomes (
Approximately 24,000 species of angiosperms (4% of them) have Bs (
Species of Cestrum exhibit a large variation in the occurrence and distribution of repetitive DNA families (
Samples of Cestrum strigilatum, C. bracteatum Link & Otto, 1828, C. corymbosum Schlechtendal, 1832, C. laevigatum Schlechtendal, 1832, C. mariquitense Kunth, 1818, C. sendtnerianum Martius, 1846, and C. schlechtendalii George Don, 1838 from Brazil are maintained in the greenhouse of the Laboratory of Cytogenetics and Plant Diversity, State University of Londrina, and vouchers are kept at the FUEL herbarium.
Root tips were pre-treated with 0.05% colchicine at room temperature for 4 h, fixed in a solution of ethanol/acetic acid (3:1,v:v) for up to 12 h and stored at -20°C. For conventional staining, samples were softened in 2% cellulase plus 20% pectinase (w:v) at 37°C, hydrolyzed in 1 M HCl for 10 min at 60°C, dissected in a drop of 45% acetic acid, and then squashed. Meiotic cells of C. strigilatum samples containing a B chromosome were obtained from young anthers, which were collected, directly fixed and dissected as described above. For both cases, after coverslips removal using freezing in liquid nitrogen, samples were stained in 2% Giemsa for conventional analysis and mounted with Entellan (Merck), or stored in 70% ethanol without staining when samples were for microdissection.
B chromosomes were isolated using an inverted Olympus IX71 microscope, equipped with Narishige micromanipulator. The B chromosome of C. strigilatum is three times smaller than those chromosomes of A set, being easily recognized and differentiated. We have dissected only those Bs that were far enough from the As, taking care to avoid contaminants. Five microdissections were made, and in each, 15 chromosomes were transferred to sterile tubes. Samples were treated with 1 µg/mL proteinase K at 60°C for 1 h and 30 min and the product was purified using phenol:chloroform (1:1, v:v), and quantified in a Nanodrop 2000 (Thermo). Afterwards, DNA of Bs was amplified using a Random Priming® kit (Invitrogen) with biotin-14-dATP for B probe production.
Sequences of 5S rDNA were amplified by PCR using as template the genomic DNA of C. strigilatum, and also a pool of 15 microdissected and purified B chromosomes of the same species. To test the reliability of reactions, three PCR repetitions were done using three different samples of microdissected B chromosomes. For this, two set of primers were used to amplify different fragments: 5S-plant-F 5’CACCGGATCCCATCAGAAACT and 5S-plant-R 5’TTAGTGCTGGTATGATCGCA, for NTS region, and UP46-F 5’GTGCGATCATACCAGCRYTAATGCACCGG and UP47-R 5’ GAGGTGCAACACGAGGACTTCCCAGGAGG, for gene coding. PCR were done using a mix containing 2 mM MgCl2, 0.4 μM of each primer, 0.2 mM dNTP, 0.2 mM DNA template, 2 U of Taq polymerase and ultrapure water to complete 25 μL. To probe labeling, 0.2 mM dNTP was changed by solution containing dGTP (25%), dCTP (25%), dTTP (25%), dATP (17.5%) and bio- or dig-dATP (7.5%). When UP46 and UP47 primers were used, thermal cycler was adjusting to the following conditions: 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 30 sec at 60°C (genome the template) or 30 sec at 50°C (B chromosome) and 1 min at 72°C, and one end of step 5 min at 72°C. When 5S-plant primers were used the conditions were: 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 40 sec at 50°C (genome and B chromosome as template) and 1 min at 72°C, and one end of step 5 min at 72°C. To check the presence of 5S rDNA fragments in the B chromosomes, both PCR products were used for FISH. The PCR products were used in a second reaction to produce templates for a Sanger sequencing, using the 3500xL Automatic Sequencer (Applied Biosystems), according to the manufacturer’s procedures. For the sequencing three distinct reactions for each primer (F and R) were done, and repeated once. The consensus sequences were obtained after alignment of 12 sequences, in which quality were tested with Phred/Phrap/Consed software, and consensus sequences were contrasted against GenBank (http://www.ncbi.nlm.nih.gov/blast) to check similarities with other 5S rDNA sequences. For FISH, a mixture of 30 µL containing 100% formamide (15 µL), 50% polyethylene glycol (6 µL), 20× SSC (3 µL), 100 ng calf thymus DNA (1 µL), 10% SDS (1 µL) and 100 ng probes (4 µL), was treated at 70 °C for 10 min, placed on ice and immediately applied to the samples. B and 35S rDNA probes were labeled with biotin by random primers and nick translation, respectively. 5S rDNA probes were labeled with biotin or digoxigenin by PCR. Denaturation/hybridization was performed at 95 °C, 50 °C and 38 °C, ten minutes each, followed by 37 °C overnight in a humidified chamber. Post-hybridization washes were carried out in 6× SSC and 4× SSC/0.2% Tween 20 (> 60% stringency), and the probes were detected using avidin-FITC (green) and anti-dig-rhodamine (red) conjugated. Post detection washes were carried out in 4× SSC/0.2% Tween 20 at room temperature. Slides were mounted in 23 µL antifade solution (90% glycerol, 2.3% DABCO, 2% 20 mM Tris–HCl, pH 8.0, plus 1 µL of 2 μg/mL DAPI and 1 µL of 2.5 mM MgCl2).
We have analyzed at least five preparations for each species and of these, at least five metaphases. All the chromosome images were acquired in gray-scale mode using a Leica DM 4500 B microscope equipped with a DFC 300FX camera and overlapped with blue for DAPI, greenish-yellow for FITC and red for rhodamine, using Leica IM50 4.0 software. The images were optimized for contrast and brightness using the GIMP 2.8 Image Editor. To ensure hybridization of the maximum possible sequences in B and A chromosomes, we did not use pre-hybridization or blocking DNA containing excess unlabeled repetitive DNA fractions, which is generally indicated for chromosome painting procedures. This allowed us to ascertain the participation of some A complement DNA fractions in the B composition. Additionally, this allowed us to determine the presence or absence of repetitive sequences in the genomes of other closely related species.
The screening for B chromosomes in the meiosis of Cestrum strigilatum showed that B always appears as univalent, without any kind of pairing with A chromosomes (Fig.
Chromosome painting using the microdissected B as probe was successfully employed in the Cestrum species. This procedure was previously used for chromosome painting in species of Secale Linnaeus, 1753, Allium Linnaeus, 1753 and Brachyscome Cassini, 1816 (see
Details of B chromosome of Cestrum strigilatum at meiosis, and FISH using the B probe against the karyotype. A Metaphase I showing the B as univalent, laterally located (arrow) B Anaphase I showing the lagging B univalent moved to one of the complements (arrow) C Late anaphase II close to one of the four complements. Note that the chromatids are partially separated (arrow) D Mitotic metaphase stained with DAPI. Arrowhead indicates the B E Mitotic metaphase hybridized with B probe. Note that some DAPI bands in D appear negative in E, but others do not. Large arrows indicate FISH signal colocalized with 5S rDNA (see also Fig.
Previous studies using FISH technique have shown that B of C. strigilatum carry no rDNA sequences (
PCR was conducted using DNA templates of the genome and microdissected B chromosome of C. strigilatum, and two distinct primer sets for amplification of different internal 5S rDNA sequences were used (Fig.
The most reasonable explanation for the positive FISH signals with the B probe in the 5S rDNA region of A chromosomes, would be the presence of one or more repetitive DNA sequences associated with the 5S rDNA. As mentioned above, there is evidence of the involvement of 5S rDNA in the origin of satDNA in Bs of P. lagopus (
Detection of 5S rDNA by PCR and FISH using probes produced with genomic and B chromosome DNA templates. A Electrophoresis gel containing: M = ladder with 250, 500, 750, 1000 bp. Lanes 1 and 3 represent fragments of about 120 bp using the UP primers using the microdissected B chromosome as template (1) and the genome as template (3). Lanes 2 and 4 represent the PCR using 5S-plant primers with microdissected B chromosome as template (see the absence of fragment in lane 2) and with genome as template (see a fragment with about 500 bp length in lane 4 B–C Double FISH showing four hybridization sites for 35S rDNA using the pTa71 probe (red) and two sites for 5S rDNA using the UP primer probe of the genome (green) in the chromosomes (B) and nucleus (C) of C. strigilatum D–F FISH using the 5S rDNA fragment amplified, using the UP primers and the microdissected B DNA as template. Note only two signals in the nucleus and prometaphase chromosomes of C. strigilatum (D, E respectively). Note also the absence of hybridization signals in the Bs (arrowheads). Bands in blue color represent AT-rich regions identified by DAPI staining. Bar = 10 µm.
Diagram representing the partial alignment of 5S rDNA sequences of Vigna (AP017185.1), Lilium (KM117262.1), Arabidopsis (AY130622.1), Cestrum aurantiacum × C. parqui (AY135508.1), Cestrum psittacinum (AF495752.1), 5SplantCestrum, 5SUPCestrum and 5SUP-BChrom, for location of gene coding and NTS regions. Note the two internal deletions in the 5S rDNA gene coding of B chromosome sequence (arrow).
Results of Blastn alignment using 5S-Plant and UP primers PCR products against B chromosomes and genome of Cestrum strigilatum
| Fragment | 5S region | Subject | Accession | Cover | Ident. | E-value |
|---|---|---|---|---|---|---|
| 5S-plant×Genome | NTS | Cestrum aurantiacum × C. parqui | AY135508.1 | 69% | 76% | 1e-60 |
| 5S-plant×Genome | NTS | Cestrum psittacinum | AF495752.1 | 42% | 83% | 2e-51 |
| UP×Genome | gene coding | Lilium tsingtauense | KM117262.1 | 95% | 96% | 5e-44 |
| UP×Genome | gene coding | Vigna angularis | AP017185.1 | 95% | 96% | 5e-44 |
| UP×5S rDNA | gene coding | Arabidopsis thaliana | AY130622.1 | 100% | 83% | 2e-33 |
| UP×B-chrom | gene coding | Vigna angularis | AP016873.1 | 92% | 82% | 6e-12 |
| UP×B-chrom | gene coding | Lilium tsingtauense | KM117262.1 | 51% | 92% | 1e-07 |
The B chromosome probe of C. strigilatum was also used to find complementarities in A chromosomes of six other Cestrum species (C. bracteatum, C. corymbosum, C. laevigatum, C. mariquitense, C. sendtnerianum, and C. schlechtendalii). FISH signals were detected in terminal, interstitial and proximal chromosome regions of these six species, but they varied in intensity, size and positioning between them. Intercalary signals were observed in one chromosome pair of C. sendtnerianum (Fig.
B chromosomes are generally under little or no selection pressure, and due to this, mobile elements and other repetitive DNA lineages may insert, spread, and amplify independently in these chromosomes (
FISH showing the location of the 35S and 5S rDNA sites, and the diversity in the distribution of B probe signals in different species of Cestrum. All species showed four terminal 35S rDNA signals (green) and two proximal 5S rDNA signals (red). Note that in all cases, the 35S probe signals did not colocalize with B probe signals, but the 5S rDNA signals did with strong signals with B probe (large arrows). A–B C. sendtnerianum: the B probe also showed intercalary signals in one chromosome pair, without evidence of scattered hybridization signals. For other species C–D C. corymbosum E–F C. laevigatum, (Fig.
The authors thank the Brazilian agencies Fundacão Araucária, CNPq and CAPES for financial support. Dr. A. Leyva helped with English editing of the manuscript.
Figure S1
Data type: JPEG file
Explanation note: A) Alignment of partial sequences of 5S rDNA of PCR product using the UP primers with C. strigilatum genome as template and PCR product using C. strigilatum B chromosome as template. Note the two internal deletions in the B chromosome amplicon, and other indels indicating a difference of 26%. B) Alignment of partial sequences of 5S rDNA of C. aurantiacum × C. parqui, AY135508.1 against PCR products using the 5S-Plant primers with C. strigilatum genome as template. Note an identity of 76% among them.